NEET 2024 Question paper with answer key pdf R2 is available for download. NEET 2024 R2 question paper has been conducted by the NTA on May 5, 2024, in pen-paper mode. NEET 2024 question paper code R2 consists of 200 MCQs- 180 to be attempted in 200 minutes. Each of the 4 subjects (Zoology, Botany, Chemistry, Physics) in NEET R2 question paper 2023 have 50 MCQs (45 to be attempted). You can download NEET 2024 question paper with answer key with solutions PDF for R2 using the links given below.
Related Links:
- Download NEET Previous Year Question Papers PDF with Solutions
- Download NEET 2024 Question Paper for all Shifts
NEET 2024 Question Paper with Answer Key PDF R2 in English
| NEET 2024 Question Paper with Answer Key | Check Solutions |
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: The potential (\(V\)) at any axial point, at 2 m distance (\(r\)) from the center of the dipole of dipole moment vector \(\vec{P}\) of magnitude, \(4 \times 10^{-6} \, \mathrm{C \, m}\), is \(\pm 9 \times 10^3 \, \mathrm{V}\).
(Take \(\frac{1}{4 \pi \epsilon_0} = 9 \times 10^9 \, \mathrm{SI \, units}\))
Reason R: \(V = \pm \frac{2P}{4 \pi \epsilon_0 r^2}\), where \(r\) is the distance of any axial point, situated at 2 m from the center of the dipole.
In the light of the above statements, choose the correct answer from the options given below:
The mass of a planet is \(\frac{1}{10}\) that of the earth, and its diameter is half that of the earth. The acceleration due to gravity on that planet is:
At any instant of time \(t\), the displacement of any particle is given by \(2t - 1 \, (\mathrm{SI \, unit})\) under the influence of a force of \(5 \, \mathrm{N}\). The value of instantaneous power is (in SI unit):
A particle moving with uniform speed in a circular path maintains:
Match List-I with List-II.
In an ideal transformer, the turns ratio is \(\frac{N_P}{N_S} = \frac{1}{2}\). The ratio \(V_S : V_P\) is equal to (the symbols carry their usual meaning):
A tightly wound \(100\)-turns coil of radius \(10 \, \mathrm{cm}\) carries a current of \(7 \, \mathrm{A}\). The magnitude of the magnetic field at the center of the coil is (Take permeability of free space as \(4 \pi \times 10^{-7} \, \mathrm{SI \, units}\)):
In the following circuit, the equivalent capacitance between terminal A and terminal B is:
In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

The maximum elongation of a steel wire of \(1 \, \mathrm{m}\) length if the elastic limit of steel and its Young's modulus, respectively, are \(8 \times 10^8 \, \mathrm{N/m^2}\) and \(2 \times 10^{11} \, \mathrm{N/m^2}\), is:
In the nuclear emission stated below, the mass number and atomic number of the product \( Q \) respectively, are:
\[ \prescript{290}{82}X \xrightarrow{\alpha} Y \xrightarrow{e^+} Z \xrightarrow{\beta^-} P \xrightarrow{e^-} Q \]
A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is \(v\) in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)?
An unpolarised light beam strikes a glass surface at Brewster's angle. Then:
In a vernier callipers, \((N + 1)\) divisions of vernier scale coincide with \(N\) divisions of the main scale. If 1 MSD represents \(0.1 \, \mathrm{mm}\), the vernier constant (in cm) is:
A bob is whirled in a horizontal plane by means of a string with an initial speed of \(\omega \, \mathrm{rpm}\). The tension in the string is \(T\). If speed becomes \(2\omega\) while keeping the same radius, the tension in the string becomes:
A thermodynamic system is taken through the cycle \(abcda\). The work done by the gas along the path \(bc\) is:
The output (\(Y\)) of the given logic gate is similar to the output of an:
Two bodies \(A\) and \(B\) of the same mass undergo a completely inelastic one-dimensional collision. Body \(A\) moves with velocity \(v_1\) while body \(B\) is at rest before the collision. The velocity of the system after the collision is \(v_2\). The ratio \(v_1 : v_2\) is:
The moment of inertia of a thin rod about an axis passing through its midpoint and perpendicular to the rod is \(2400 \, \mathrm{g \, cm^2}\). The length of the \(400 \, \mathrm{g}\) rod is nearly:
A thin flat circular disc of radius \(4.5 \, \mathrm{cm}\) is placed gently over the surface of water. If the surface tension of water is \(0.07 \, \mathrm{N/m}\), then the excess force required to take it away from the surface is:
Consider the following statements A and B and identify the correct answer:
A. For a solar-cell, the \(I-V\) characteristics lie in the IV quadrant of the given graph.
B. In a reverse biased \(pn\)-junction diode, the current measured (in \(\mu A\)) is due to majority charge carriers.
A horizontal force of \(10 \, \mathrm{N}\) is applied to a block \(A\) as shown in the figure. The masses of blocks \(A\) and \(B\) are \(2 \, \mathrm{kg}\) and \(3 \, \mathrm{kg}\), respectively. The blocks slide over a frictionless surface. The force exerted by block \(A\) on block \(B\) is:
If \(x = 5 \sin\left(\pi t+\frac{\pi }{3}\right) \, \mathrm{m}\) represents the motion of a particle executing simple harmonic motion, the amplitude and time period of the motion, respectively, are:
A light ray enters through a right-angled prism at point \(P\) with the angle of incidence \(30^\circ\) as shown in the figure. It travels through the prism parallel to its base \(BC\) and emerges along the face \(AC\). The refractive index of the prism is:
A thin spherical shell is charged by some source. The potential difference between the two points \(C\) and \(P\) (in \(V\)) shown in the figure is: (Take \(\frac{1}{4 \pi \epsilon_0} = 9 \times 10^9 \, \mathrm{SI \, units}\)):
If \( c \) is the velocity of light in free space, the correct statements about photons among the following are:
A. The energy of a photon is \( E = h\nu \).
B. The velocity of a photon is \( c \).
C. The momentum of a photon, \( p = \frac{h\nu}{c} \).
D. In a photon-electron collision, both total energy and total momentum are conserved.
E. Photon possesses a positive charge.
Choose the correct answer from the options given below:
Match List-I with List-II:
Given below are two statements:
Statement I: Atoms are electrically neutral as they contain equal numbers of positive and negative charges.
Statement II: Atoms of each element are stable and emit their characteristic spectrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
The terminal voltage of the battery, whose emf is \(10 \, \mathrm{V}\) and internal resistance \(1 \, \Omega\), when connected through an external resistance of \(4 \, \Omega\) as shown in the figure, is:
If the monochromatic source in Young's double-slit experiment is replaced by white light, then:
A logic circuit provides the output \(Y\) as per the following truth table:
The expression for the output \(Y\) is:
A wire of length \(l\) and resistance \(100 \, \Omega\) is divided into 10 equal parts. The first 5 parts are connected in series, while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:
The quantities which have the same dimensions as those of solid angle are:
The graph which shows the variation of \((1/\lambda^2)\) and its kinetic energy, \(E\), is (where \(\lambda\) is de Broglie wavelength of a free particle):
In a uniform magnetic field of \(0.049 \, \mathrm{T}\), a magnetic needle performs \(20\) complete oscillations in \(5 \, \mathrm{s}\). The moment of inertia of the needle is \(9.8 \times 10^{-6} \, \mathrm{kg \, m^2}\). If the magnitude of the magnetic moment of the needle is \(x \times 10^{-5} \, \mathrm{Am^2}\), then the value of \(x\) is:
If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then:
A. The charge stored in it increases.
B. The energy stored in it decreases.
C. Its capacitance increases.
D. The ratio of charge to its potential remains the same.
E. The product of charge and voltage increases.
Choose the most appropriate answer from the options given below:
A metallic bar of Young’s modulus, \(0.5 \times 10^{11} \, \mathrm{N/m^2}\) and coefficient of linear thermal expansion \(10^{-5} \, ^\circ\mathrm{C}^{-1}\), length \(1 \, \mathrm{m}\), and area of cross-section \(10^{-3} \, \mathrm{m^2}\) is heated from \(0^\circ\mathrm{C}\) to \(100^\circ\mathrm{C}\) without expansion or bending. The compressive force developed in it is:
If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is \(\frac{x}{2}\) times its original time period. The value of \(x\) is:
A small telescope has an objective of focal length \(140 \, \mathrm{cm}\) and an eyepiece of focal length \(5.0 \, \mathrm{cm}\). The magnifying power of the telescope for viewing a distant object is:
Two heaters \(A\) and \(B\) have power ratings of \(1 \, \mathrm{kW}\) and \(2 \, \mathrm{kW}\), respectively. The two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:
A force defined by \(F = \alpha t^2 + \beta t\) acts on a particle at a given time \(t\). The factor which is dimensionless, if \(\alpha\) and \(\beta\) are constants, is:
A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:
A. Hold the sheet there if it is magnetic.
B. Hold the sheet there if it is non-magnetic.
C. Move the sheet away from the pole with uniform velocity if it is conducting.
D. Move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.
Choose the correct statement(s) from the options given below:
Choose the correct circuit which can achieve the bridge balance.
The velocity (\(v\)) – time (\(t\)) plot of the motion of a body is shown below:
The acceleration (\(a\)) – time (\(t\)) graph that best suits this motion is:
A \(10 \, \mu\mathrm{F}\) capacitor is connected to a \(210 \, \mathrm{V}\), \(50 \, \mathrm{Hz}\) source as shown in figure. The peak current in the circuit is nearly (\(\pi = 3.14\)):
The property which is not of an electromagnetic wave traveling in free space is that:
The following graph represents the T-V curves of an ideal gas (where \(T\) is the temperature and \(V\) the volume) at three pressures \(P_1\), \(P_2\), and \(P_3\) compared with those of Charles's law represented as dotted lines.
The minimum energy required to launch a satellite of mass \(m\) from the surface of Earth of mass \(M\) and radius \(R\) into a circular orbit at an altitude of \(2R\) from the surface is:
A parallel plate capacitor is charged by connecting it to a battery through a resistor. If \(I\) is the current in the circuit, then in the gap between the plates:
An iron bar of length \(L\) has magnetic moment \(M\). It is bent at the middle of its length such that the two arms make an angle \(60^\circ\) with each other. The magnetic moment of this new magnet is:
The compound that will undergo \( SN_1 \) reaction with the fastest rate is:
Given below are two statements:
Statement I: Both \([Co(NH_3)_6]^{3+}\) and \([CoF_6]^{3-}\) complexes are octahedral but differ in their magnetic behavior.
Statement II: \([Co(NH_3)_6]^{3+}\) is diamagnetic whereas \([CoF_6]^{3-}\) is paramagnetic.
In the light of the above statements, choose the correct answer from the options given below:
Match List I with List II:
Intramolecular hydrogen bonding is present in:
In which of the following processes does entropy increase?
A. A liquid evaporates to vapor.
B. Temperature of a crystalline solid is lowered from 130 K to 0 K.
C. \( 2NaHCO_3 (s) \rightarrow Na_2CO_3 (s) + CO_2 (g) + H_2O (g) \)
D. \( Cl_2 (g) \rightarrow 2Cl(g) \)
Choose the correct answer from the options given below:
Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N.
In which of the following equilibria are \(K_p\) and \(K_c\) NOT equal?
Match List I with List II.
The most stable carbocation among the following is:
1 gram of sodium hydroxide was treated with \(25 \, \mathrm{mL}\) of \(0.75 \, \mathrm{M} \, \mathrm{HCl}\). The mass of sodium hydroxide left unreacted is equal to:
The Henry's law constant (\(K_H\)) values of three gases (A, B, C) in water are \(145 ,\ 2 \times 10^ {-5} and \ 35 \ \mathrm{kbar}\), \(2 \times 10^{-5} \, \mathrm{kbar}\), and \(35 \, \mathrm{kbar}\), respectively. The solubility of these gases in water follows the order:
Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si.
Choose the correct answer from the options given below:
Among Group 16 elements, which one does NOT show \(-2\) oxidation state?
The \(E^\circ\) value for the \(\mathrm{Mn^{3+}/Mn^{2+}}\) couple is more positive than that of \(\mathrm{Cr^{3+}/Cr^{2+}}\) or \(\mathrm{Fe^{3+}/Fe^{2+}}\) due to change of:
Match List I with List II.
Given below are two statements:
Statement I: The boiling point of hydrides of Group 16 elements follows the order \( H_2O \(>\) H_2Te \(>\) H_2Se \(>\) H_2S \).
Statement II: On the basis of molecular mass, \( H_2O \) is expected to have a lower boiling point than the other members of the group, but due to the presence of extensive hydrogen bonding in \( H_2O \), it has a higher boiling point.
Choose the correct answer from the options given below:
Which plot of \(\ln k\) vs \(\frac{1}{T}\) is consistent with the Arrhenius equation?
The highest number of helium atoms is in:
The reagents with which glucose does not react to give the corresponding tests/products are:
A. Tollen’s reagent
B. Schiff’s reagent
C. HCN
D. \(NH_2OH\)
E. \(NaHSO_3\)
Choose the correct options from the given below:
Match List I with List II.
Match List I with List II.
Match List I with List II.
Choose the correct answer from the options given below:
A compound with a molecular formula of \(C_6H_{14}\) has two tertiary carbons. Its IUPAC name is:
Which one of the following alcohols reacts instantaneously with Lucas reagent?
On heating, some solid substances change directly to vapor without passing through the liquid state. The purification method based on this principle is known as:
The energy of an electron in the ground state (\(n = 1\)) for \(He^+\) ion is \(-x\) J. Then that for an electron in \(n = 2\) state for \(Be^{3+}\) ion in J is:
Which reaction is NOT a redox reaction?
Activation energy of any chemical reaction can be calculated if one knows the value of:
Identify the correct reagents that would bring about the following transformation.
Given below are two statements:
Statement I: The boiling point of three isomeric pentanes follows the order \(n\)-pentane \(>\) isopentane \(>\) neopentane.
Statement II: When branching increases, the molecule attains a shape of a sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.
Choose the most appropriate answer from the options given below:
Fehling’s solution 'A' is:
‘Spin only’ magnetic moment is the same for which of the following ions?
A. \(Ti^{3+}\)
B. \(Cr^{2+}\)
C. \(Mn^{2+}\)
D.\(Fe^{2+}\)
E. \(Sc^{3+}\)
For the reaction \(2A \rightleftharpoons B + C\), \(K_c = 4 \times 10^{-3}\). At a given time, the composition of the reaction mixture is: [A] = [B] = [C] = \(2 \times 10^{-3}\) M. Then, which of the following is correct?
Match List I with List II.
Given below are two statements:
Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction.
Statement II: Aniline cannot be prepared through Gabriel synthesis.
Choose the correct answer from the options given below:
Identify the correct answer.
During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe\(^{2+}\) ion?
Given below are two statements:
Statement I: \([Co(NH_3)_6]^{3+}\) is a homoleptic complex, whereas \([Co(NH_3)_4Cl_2]^+\) is a heteroleptic complex.
Statement II: Complex \([Co(NH_3)_6]^{3+}\) has only one kind of ligands but \([Co(NH_3)_4Cl_2]^+\) has more than one kind of ligands.
Choose the correct answer from the options given below:
Major products A and B formed in the following reaction sequence, are:
Identify the major product C formed in the following reaction sequence:
Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given: Molar mass of Cu: 63 g mol\(^{-1}\), 1 F = 96487 C):
For the given reaction:
'P' is
Consider the following reaction in a sealed vessel at equilibrium with concentrations of N\(_2\) = \(3.0 \times 10^{-3}\) M, O\(_2\) = \(4.2 \times 10^{-3}\) M, and NO = \(2.8 \times 10^{-3}\) M.
\[ 2NO(g) \rightleftharpoons N_2(g) + O_2(g) \]
If 0.1 mol L\(^{-1}\) of NO(g) is taken in a closed vessel, what will be the degree of dissociation (\(\alpha\)) of NO(g) at equilibrium?
The products A and B obtained in the following reactions, respectively, are:
\[ 3ROH + PCl_3 \to 3RCl + A \] \[ ROH + PCl_5 \to RCl + HCl + B \]
The plot of osmotic pressure (\(\Pi\)) vs concentration (mol L\(^{-1}\)) for a solution gives a straight line with slope 25.73 L bar mol\(^{-1}\). The temperature at which the osmotic pressure measurement is done is (Use \(R = 0.083 \, L bar mol^{-1} K^{-1}\)):
The pair of lanthanoid ions which are diamagnetic is:
The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is (Given \(R = 2.0 \, cal mol^{-1} \, K^{-1}\)):
Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.
A. Al\(^{3+}\)
B. Cu\(^{2+}\)
C. Ba\(^{2+}\)
D. Co\(^{2+}\)
E. Mg\(^{2+}\)
The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of activation. Given \(R = 8.314 \, J K^{-1} \, mol^{-1}\), \(log_4\) = 0.6021
A compound X contains 32% of A, 20% of B and the remaining percentage of C. Then, the empirical formula of X is: (Given atomic masses of A = 64; B = 40; C = 32 u)
Spindle fibers attach to kinetochores of chromosomes during
Bulliform cells are responsible for
The capacity to generate a whole plant from any cell of the plant is called:
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream ends;
Match List I with List II
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Hind II always cuts DNA molecules at a particular point called recognition sequence, and it consists of:
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?
These are regarded as major causes of biodiversity loss:
A. Over exploitation
B. Co-extinction
C. Mutation
D. Habitat loss and fragmentation
E. Migration
Choose the correct option:
How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?
Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors, one is dominant and the other is recessive.
B. Alleles do not show any expression, and both the characters appear as such in F2 generation.
C. Factors occur in pairs in normal diploid plants.
D. The discrete unit controlling a particular character is called factor.
E. The expression of only one of the parental characters is found in a monohybrid cross.
Choose the correct answer from the options given below:
List of endangered species was released by
Tropical regions show the greatest level of species richness because
A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.
B. Tropical environments are more seasonal.
C. More solar energy is available in tropics.
D. Constant environments promote niche specialization.
E. Tropical environments are constant and predictable.
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Which of the following is an example of an actinomorphic flower?
Identify the set of correct statements:
A. The flowers of Vallisneria are colourful and produce nectar.
B. The flowers of water lily are not pollinated by water.
C. In most of water-pollinated species, the pollen grains are protected from wetting.
D. Pollen grains of some hydrophytes are long and ribbon-like.
E. In some hydrophytes, the pollen grains are carried passively inside water.
Choose the correct answer from the options given below:
What is the fate of a piece of DNA carrying only the gene of interest which is transferred into an alien organism?
Given below are two statements:
Statement I: Parenchyma is living, but collenchyma is dead tissue.
Statement II: Gymnosperms lack xylem vessels, but the presence of xylem vessels is the characteristic of angiosperms.
In the light of the above statements, choose the correct answer from the options given below:
Formation of interfascicular cambium from fully developed parenchyma cells is an example of
Which one of the following is not a criterion for classification of fungi?
The cofactor of the enzyme carboxypeptidase is:
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. CO₂
D. ATP
E. NADPH
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
The lactose present in the growth medium of bacteria is transported to the cell by the action of
The equation of Verhulst-Pearl logistic growth is \[ \frac{dN}{dt} = rN \left( 1 - \frac{N}{K} \right) \]
From this equation, \( K \) indicates:
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
The type of conservation in which the threatened species are taken out from their natural habitat and placed in special settings where they can be protected and given special care is called
Identify the type of flowers based on the position of calyx, corolla, and androecium with respect to the ovary from the given figures (a) and (b)
Given below are two statements:
Statement I: Bt toxins are insect group specific and coded by a gene cry IAc.
Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect, the inactive protoxin gets converted into the active form due to the acidic pH of the insect gut.
In the light of the above statements, choose the correct answer from the options given below:
Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
Given below are two statements:
Statement I: Chromosomes become gradually visible under light microscope during the leptotene stage.
Statement II: The beginning of the diplotene stage is recognized by the dissolution of the synaptonemal complex.
In the light of the above statements, choose the correct answer from the options given below:
Identify the part of the seed from the given figure which is destined to form the root when the seed germinates.
In the given figure, which component has thin outer walls and highly thickened inner walls?
Match List-I with List-II
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Spraying sugarcane crop with which of the following plant growth regulators increases the length of stem, thus, increasing the yield?
Match List I with List II
Choose the correct answer from the options given below:
In an ecosystem, if the Net Primary Productivity (NPP) of the first trophic level is 100x (kcal m–2 yr–1), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
Which of the following are fused in somatic hybridization involving two varieties of plants?
Match List I with List II
Choose the correct answer from the options given below:
Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.
Choose the correct answer from the options given below:
Which of the following statement is correct regarding the process of replication in E. coli?
The DNA present in chloroplast is:
Identify the correct description about the given figure:
Given below are two statements:
Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.
Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.
In the light of the above statements, choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:
Name of muscle/location
Following are the stages of the pathway for conduction of an action potential through the heart:
A. AV bundle \quad B. Purkinje fibres \quad C. AV node \quad D. Bundle branches \quad E. SA node
Choose the correct sequence of the pathway from the options given below:
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
Which of the following statements is incorrect?
Which one is the correct product of DNA-dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
Match List I with List II

Choose the correct answer from the options given below:
Which of the following are Autoimmune disorders?
A. Myasthenia gravis
B. Rheumatoid arthritis
C. Gout
D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are two statements:
Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.
Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.
In the light of the above statements, choose the correct answer from the options given below:
Match List I with List
II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Following are the stages of cell division:
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
The flippers of the Penguins and Dolphins are the example of:
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.
Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.
In the light of the above statements, choose the most appropriate answer from the options given below:
Which of the following is not a component of the Fallopian tube?
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)
A. Homo habilis
B. Homo sapiens
C. Homo neanderthalensis
D. Homo erectus
Choose the correct sequence of human evolution from the options given below:
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
In the light of the above statements, choose the correct answer from the options given below:
Which of the following is not a steroid hormone?
Consider the following statements:
A. Annelids are true coelomates.
B. Poriferans are pseudocoelomates.
C. Aschelminthes are acoelomates.
D. Platyhelminthes are pseudocoelomates.
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:
Match List I with List II:
Choose the correct answer from the options given below:
The “Ti plasmid” of Agrobacterium tumefaciens stands for:
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: The presence or absence of hymen is not a reliable indicator of virginity.
Reason R: The hymen is torn during the first coitus only.
In the light of the above statements, choose the correct answer from the options given below:
The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:
Which of the following is not a natural/traditional contraceptive method?
Match List I with List II:
Choose the correct answer from the options given below:
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
Given below are two statements:
Statement I: Mitochondria and chloroplasts both are double-membrane bound organelles.
Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.
In the light of the above statements, choose the most appropriate answer from the options given below:
Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.
In the light of the above statements, choose the correct answer from the options given below:
Regarding catalytic cycle of an enzyme action, select the correct sequential steps:
A. Substrate-enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to active site.
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are two statements:
Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
Match List I with List II related to digestive system of cockroach:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are two statements:
Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.
Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.
In the light of the above statements, choose the most appropriate answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Choose the correct statement given below regarding juxta medullary nephron:
As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be:
The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post anal tail is absent.
Choose the most appropriate answer from the options given below:
NEET Previous Year Question Papers with Answer Keys
| NEET 2023 Question Papers | NEET 2022 Question Papers | NEET 2021 Question Papers |
| NEET 2020 Question Papers | NEET 2019 Question Papers | NEET 2018 Question Papers |
Other UG Entrance Exams
| MHT CET Previous Year Question Papers | OJEE Previous Year Question Papers |
| TS EAMCET Previous Year Question Papers | AP EAMCET Previous Year Question Papers |
NEET 2024 Question paper with answer key pdf R2 is available for download. NEET 2024 R2 question paper has been conducted by the NTA on May 5, 2024, in pen-paper mode. NEET 2024 question paper code R2 consists of 200 MCQs- 180 to be attempted in 200 minutes. Each of the 4 subjects (Zoology, Botany, Chemistry, Physics) in NEET R2 question paper 2023 have 50 MCQs (45 to be attempted). You can download NEET 2024 question paper with answer key with solutions PDF for R2 using the links given below.
Related Links:
- Download NEET Previous Year Question Papers PDF with Solutions
- Download NEET 2024 Question Paper for all Shifts
NEET 2024 Question Paper with Answer Key PDF R2 in English
| NEET 2024 Question Paper with Answer Key | Check Solutions |
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: The potential (\(V\)) at any axial point, at 2 m distance (\(r\)) from the center of the dipole of dipole moment vector \(\vec{P}\) of magnitude, \(4 \times 10^{-6} \, \mathrm{C \, m}\), is \(\pm 9 \times 10^3 \, \mathrm{V}\).
(Take \(\frac{1}{4 \pi \epsilon_0} = 9 \times 10^9 \, \mathrm{SI \, units}\))
Reason R: \(V = \pm \frac{2P}{4 \pi \epsilon_0 r^2}\), where \(r\) is the distance of any axial point, situated at 2 m from the center of the dipole.
In the light of the above statements, choose the correct answer from the options given below:
The mass of a planet is \(\frac{1}{10}\) that of the earth, and its diameter is half that of the earth. The acceleration due to gravity on that planet is:
At any instant of time \(t\), the displacement of any particle is given by \(2t - 1 \, (\mathrm{SI \, unit})\) under the influence of a force of \(5 \, \mathrm{N}\). The value of instantaneous power is (in SI unit):
A particle moving with uniform speed in a circular path maintains:
Match List-I with List-II.
In an ideal transformer, the turns ratio is \(\frac{N_P}{N_S} = \frac{1}{2}\). The ratio \(V_S : V_P\) is equal to (the symbols carry their usual meaning):
A tightly wound \(100\)-turns coil of radius \(10 \, \mathrm{cm}\) carries a current of \(7 \, \mathrm{A}\). The magnitude of the magnetic field at the center of the coil is (Take permeability of free space as \(4 \pi \times 10^{-7} \, \mathrm{SI \, units}\)):
In the following circuit, the equivalent capacitance between terminal A and terminal B is:
In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

The maximum elongation of a steel wire of \(1 \, \mathrm{m}\) length if the elastic limit of steel and its Young's modulus, respectively, are \(8 \times 10^8 \, \mathrm{N/m^2}\) and \(2 \times 10^{11} \, \mathrm{N/m^2}\), is:
In the nuclear emission stated below, the mass number and atomic number of the product \( Q \) respectively, are:
\[ \prescript{290}{82}X \xrightarrow{\alpha} Y \xrightarrow{e^+} Z \xrightarrow{\beta^-} P \xrightarrow{e^-} Q \]
A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is \(v\) in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)?
An unpolarised light beam strikes a glass surface at Brewster's angle. Then:
In a vernier callipers, \((N + 1)\) divisions of vernier scale coincide with \(N\) divisions of the main scale. If 1 MSD represents \(0.1 \, \mathrm{mm}\), the vernier constant (in cm) is:
A bob is whirled in a horizontal plane by means of a string with an initial speed of \(\omega \, \mathrm{rpm}\). The tension in the string is \(T\). If speed becomes \(2\omega\) while keeping the same radius, the tension in the string becomes:
A thermodynamic system is taken through the cycle \(abcda\). The work done by the gas along the path \(bc\) is:
The output (\(Y\)) of the given logic gate is similar to the output of an:
Two bodies \(A\) and \(B\) of the same mass undergo a completely inelastic one-dimensional collision. Body \(A\) moves with velocity \(v_1\) while body \(B\) is at rest before the collision. The velocity of the system after the collision is \(v_2\). The ratio \(v_1 : v_2\) is:
The moment of inertia of a thin rod about an axis passing through its midpoint and perpendicular to the rod is \(2400 \, \mathrm{g \, cm^2}\). The length of the \(400 \, \mathrm{g}\) rod is nearly:
A thin flat circular disc of radius \(4.5 \, \mathrm{cm}\) is placed gently over the surface of water. If the surface tension of water is \(0.07 \, \mathrm{N/m}\), then the excess force required to take it away from the surface is:
Consider the following statements A and B and identify the correct answer:
A. For a solar-cell, the \(I-V\) characteristics lie in the IV quadrant of the given graph.
B. In a reverse biased \(pn\)-junction diode, the current measured (in \(\mu A\)) is due to majority charge carriers.
A horizontal force of \(10 \, \mathrm{N}\) is applied to a block \(A\) as shown in the figure. The masses of blocks \(A\) and \(B\) are \(2 \, \mathrm{kg}\) and \(3 \, \mathrm{kg}\), respectively. The blocks slide over a frictionless surface. The force exerted by block \(A\) on block \(B\) is:
If \(x = 5 \sin\left(\pi t+\frac{\pi }{3}\right) \, \mathrm{m}\) represents the motion of a particle executing simple harmonic motion, the amplitude and time period of the motion, respectively, are:
A light ray enters through a right-angled prism at point \(P\) with the angle of incidence \(30^\circ\) as shown in the figure. It travels through the prism parallel to its base \(BC\) and emerges along the face \(AC\). The refractive index of the prism is:
A thin spherical shell is charged by some source. The potential difference between the two points \(C\) and \(P\) (in \(V\)) shown in the figure is: (Take \(\frac{1}{4 \pi \epsilon_0} = 9 \times 10^9 \, \mathrm{SI \, units}\)):
If \( c \) is the velocity of light in free space, the correct statements about photons among the following are:
A. The energy of a photon is \( E = h\nu \).
B. The velocity of a photon is \( c \).
C. The momentum of a photon, \( p = \frac{h\nu}{c} \).
D. In a photon-electron collision, both total energy and total momentum are conserved.
E. Photon possesses a positive charge.
Choose the correct answer from the options given below:
Match List-I with List-II:
Given below are two statements:
Statement I: Atoms are electrically neutral as they contain equal numbers of positive and negative charges.
Statement II: Atoms of each element are stable and emit their characteristic spectrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
The terminal voltage of the battery, whose emf is \(10 \, \mathrm{V}\) and internal resistance \(1 \, \Omega\), when connected through an external resistance of \(4 \, \Omega\) as shown in the figure, is:
If the monochromatic source in Young's double-slit experiment is replaced by white light, then:
A logic circuit provides the output \(Y\) as per the following truth table:
The expression for the output \(Y\) is:
A wire of length \(l\) and resistance \(100 \, \Omega\) is divided into 10 equal parts. The first 5 parts are connected in series, while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:
The quantities which have the same dimensions as those of solid angle are:
The graph which shows the variation of \((1/\lambda^2)\) and its kinetic energy, \(E\), is (where \(\lambda\) is de Broglie wavelength of a free particle):
In a uniform magnetic field of \(0.049 \, \mathrm{T}\), a magnetic needle performs \(20\) complete oscillations in \(5 \, \mathrm{s}\). The moment of inertia of the needle is \(9.8 \times 10^{-6} \, \mathrm{kg \, m^2}\). If the magnitude of the magnetic moment of the needle is \(x \times 10^{-5} \, \mathrm{Am^2}\), then the value of \(x\) is:
If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then:
A. The charge stored in it increases.
B. The energy stored in it decreases.
C. Its capacitance increases.
D. The ratio of charge to its potential remains the same.
E. The product of charge and voltage increases.
Choose the most appropriate answer from the options given below:
A metallic bar of Young’s modulus, \(0.5 \times 10^{11} \, \mathrm{N/m^2}\) and coefficient of linear thermal expansion \(10^{-5} \, ^\circ\mathrm{C}^{-1}\), length \(1 \, \mathrm{m}\), and area of cross-section \(10^{-3} \, \mathrm{m^2}\) is heated from \(0^\circ\mathrm{C}\) to \(100^\circ\mathrm{C}\) without expansion or bending. The compressive force developed in it is:
If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is \(\frac{x}{2}\) times its original time period. The value of \(x\) is:
A small telescope has an objective of focal length \(140 \, \mathrm{cm}\) and an eyepiece of focal length \(5.0 \, \mathrm{cm}\). The magnifying power of the telescope for viewing a distant object is:
Two heaters \(A\) and \(B\) have power ratings of \(1 \, \mathrm{kW}\) and \(2 \, \mathrm{kW}\), respectively. The two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:
A force defined by \(F = \alpha t^2 + \beta t\) acts on a particle at a given time \(t\). The factor which is dimensionless, if \(\alpha\) and \(\beta\) are constants, is:
A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:
A. Hold the sheet there if it is magnetic.
B. Hold the sheet there if it is non-magnetic.
C. Move the sheet away from the pole with uniform velocity if it is conducting.
D. Move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.
Choose the correct statement(s) from the options given below:
Choose the correct circuit which can achieve the bridge balance.
The velocity (\(v\)) – time (\(t\)) plot of the motion of a body is shown below:
The acceleration (\(a\)) – time (\(t\)) graph that best suits this motion is:
A \(10 \, \mu\mathrm{F}\) capacitor is connected to a \(210 \, \mathrm{V}\), \(50 \, \mathrm{Hz}\) source as shown in figure. The peak current in the circuit is nearly (\(\pi = 3.14\)):
The property which is not of an electromagnetic wave traveling in free space is that:
The following graph represents the T-V curves of an ideal gas (where \(T\) is the temperature and \(V\) the volume) at three pressures \(P_1\), \(P_2\), and \(P_3\) compared with those of Charles's law represented as dotted lines.
The minimum energy required to launch a satellite of mass \(m\) from the surface of Earth of mass \(M\) and radius \(R\) into a circular orbit at an altitude of \(2R\) from the surface is:
A parallel plate capacitor is charged by connecting it to a battery through a resistor. If \(I\) is the current in the circuit, then in the gap between the plates:
An iron bar of length \(L\) has magnetic moment \(M\). It is bent at the middle of its length such that the two arms make an angle \(60^\circ\) with each other. The magnetic moment of this new magnet is:
The compound that will undergo \( SN_1 \) reaction with the fastest rate is:
Given below are two statements:
Statement I: Both \([Co(NH_3)_6]^{3+}\) and \([CoF_6]^{3-}\) complexes are octahedral but differ in their magnetic behavior.
Statement II: \([Co(NH_3)_6]^{3+}\) is diamagnetic whereas \([CoF_6]^{3-}\) is paramagnetic.
In the light of the above statements, choose the correct answer from the options given below:
Match List I with List II:
Intramolecular hydrogen bonding is present in:
In which of the following processes does entropy increase?
A. A liquid evaporates to vapor.
B. Temperature of a crystalline solid is lowered from 130 K to 0 K.
C. \( 2NaHCO_3 (s) \rightarrow Na_2CO_3 (s) + CO_2 (g) + H_2O (g) \)
D. \( Cl_2 (g) \rightarrow 2Cl(g) \)
Choose the correct answer from the options given below:
Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N.
In which of the following equilibria are \(K_p\) and \(K_c\) NOT equal?
Match List I with List II.
The most stable carbocation among the following is:
1 gram of sodium hydroxide was treated with \(25 \, \mathrm{mL}\) of \(0.75 \, \mathrm{M} \, \mathrm{HCl}\). The mass of sodium hydroxide left unreacted is equal to:
The Henry's law constant (\(K_H\)) values of three gases (A, B, C) in water are \(145 ,\ 2 \times 10^ {-5} and \ 35 \ \mathrm{kbar}\), \(2 \times 10^{-5} \, \mathrm{kbar}\), and \(35 \, \mathrm{kbar}\), respectively. The solubility of these gases in water follows the order:
Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si.
Choose the correct answer from the options given below:
Among Group 16 elements, which one does NOT show \(-2\) oxidation state?
The \(E^\circ\) value for the \(\mathrm{Mn^{3+}/Mn^{2+}}\) couple is more positive than that of \(\mathrm{Cr^{3+}/Cr^{2+}}\) or \(\mathrm{Fe^{3+}/Fe^{2+}}\) due to change of:
Match List I with List II.
Given below are two statements:
Statement I: The boiling point of hydrides of Group 16 elements follows the order \( H_2O \(>\) H_2Te \(>\) H_2Se \(>\) H_2S \).
Statement II: On the basis of molecular mass, \( H_2O \) is expected to have a lower boiling point than the other members of the group, but due to the presence of extensive hydrogen bonding in \( H_2O \), it has a higher boiling point.
Choose the correct answer from the options given below:
Which plot of \(\ln k\) vs \(\frac{1}{T}\) is consistent with the Arrhenius equation?
The highest number of helium atoms is in:
The reagents with which glucose does not react to give the corresponding tests/products are:
A. Tollen’s reagent
B. Schiff’s reagent
C. HCN
D. \(NH_2OH\)
E. \(NaHSO_3\)
Choose the correct options from the given below:
Match List I with List II.
Match List I with List II.
Match List I with List II.
Choose the correct answer from the options given below:
A compound with a molecular formula of \(C_6H_{14}\) has two tertiary carbons. Its IUPAC name is:
Which one of the following alcohols reacts instantaneously with Lucas reagent?
On heating, some solid substances change directly to vapor without passing through the liquid state. The purification method based on this principle is known as:
The energy of an electron in the ground state (\(n = 1\)) for \(He^+\) ion is \(-x\) J. Then that for an electron in \(n = 2\) state for \(Be^{3+}\) ion in J is:
Which reaction is NOT a redox reaction?
Activation energy of any chemical reaction can be calculated if one knows the value of:
Identify the correct reagents that would bring about the following transformation.
Given below are two statements:
Statement I: The boiling point of three isomeric pentanes follows the order \(n\)-pentane \(>\) isopentane \(>\) neopentane.
Statement II: When branching increases, the molecule attains a shape of a sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.
Choose the most appropriate answer from the options given below:
Fehling’s solution 'A' is:
‘Spin only’ magnetic moment is the same for which of the following ions?
A. \(Ti^{3+}\)
B. \(Cr^{2+}\)
C. \(Mn^{2+}\)
D.\(Fe^{2+}\)
E. \(Sc^{3+}\)
For the reaction \(2A \rightleftharpoons B + C\), \(K_c = 4 \times 10^{-3}\). At a given time, the composition of the reaction mixture is: [A] = [B] = [C] = \(2 \times 10^{-3}\) M. Then, which of the following is correct?
Match List I with List II.
Given below are two statements:
Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction.
Statement II: Aniline cannot be prepared through Gabriel synthesis.
Choose the correct answer from the options given below:
Identify the correct answer.
During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe\(^{2+}\) ion?
Given below are two statements:
Statement I: \([Co(NH_3)_6]^{3+}\) is a homoleptic complex, whereas \([Co(NH_3)_4Cl_2]^+\) is a heteroleptic complex.
Statement II: Complex \([Co(NH_3)_6]^{3+}\) has only one kind of ligands but \([Co(NH_3)_4Cl_2]^+\) has more than one kind of ligands.
Choose the correct answer from the options given below:
Major products A and B formed in the following reaction sequence, are:
Identify the major product C formed in the following reaction sequence:
Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given: Molar mass of Cu: 63 g mol\(^{-1}\), 1 F = 96487 C):
For the given reaction:
'P' is
Consider the following reaction in a sealed vessel at equilibrium with concentrations of N\(_2\) = \(3.0 \times 10^{-3}\) M, O\(_2\) = \(4.2 \times 10^{-3}\) M, and NO = \(2.8 \times 10^{-3}\) M.
\[ 2NO(g) \rightleftharpoons N_2(g) + O_2(g) \]
If 0.1 mol L\(^{-1}\) of NO(g) is taken in a closed vessel, what will be the degree of dissociation (\(\alpha\)) of NO(g) at equilibrium?
The products A and B obtained in the following reactions, respectively, are:
\[ 3ROH + PCl_3 \to 3RCl + A \] \[ ROH + PCl_5 \to RCl + HCl + B \]
The plot of osmotic pressure (\(\Pi\)) vs concentration (mol L\(^{-1}\)) for a solution gives a straight line with slope 25.73 L bar mol\(^{-1}\). The temperature at which the osmotic pressure measurement is done is (Use \(R = 0.083 \, L bar mol^{-1} K^{-1}\)):
The pair of lanthanoid ions which are diamagnetic is:
The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is (Given \(R = 2.0 \, cal mol^{-1} \, K^{-1}\)):
Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.
A. Al\(^{3+}\)
B. Cu\(^{2+}\)
C. Ba\(^{2+}\)
D. Co\(^{2+}\)
E. Mg\(^{2+}\)
The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of activation. Given \(R = 8.314 \, J K^{-1} \, mol^{-1}\), \(log_4\) = 0.6021
A compound X contains 32% of A, 20% of B and the remaining percentage of C. Then, the empirical formula of X is: (Given atomic masses of A = 64; B = 40; C = 32 u)
Spindle fibers attach to kinetochores of chromosomes during
Bulliform cells are responsible for
The capacity to generate a whole plant from any cell of the plant is called:
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream ends;
Match List I with List II
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Hind II always cuts DNA molecules at a particular point called recognition sequence, and it consists of:
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?
These are regarded as major causes of biodiversity loss:
A. Over exploitation
B. Co-extinction
C. Mutation
D. Habitat loss and fragmentation
E. Migration
Choose the correct option:
How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?
Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors, one is dominant and the other is recessive.
B. Alleles do not show any expression, and both the characters appear as such in F2 generation.
C. Factors occur in pairs in normal diploid plants.
D. The discrete unit controlling a particular character is called factor.
E. The expression of only one of the parental characters is found in a monohybrid cross.
Choose the correct answer from the options given below:
List of endangered species was released by
Tropical regions show the greatest level of species richness because
A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.
B. Tropical environments are more seasonal.
C. More solar energy is available in tropics.
D. Constant environments promote niche specialization.
E. Tropical environments are constant and predictable.
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Which of the following is an example of an actinomorphic flower?
Identify the set of correct statements:
A. The flowers of Vallisneria are colourful and produce nectar.
B. The flowers of water lily are not pollinated by water.
C. In most of water-pollinated species, the pollen grains are protected from wetting.
D. Pollen grains of some hydrophytes are long and ribbon-like.
E. In some hydrophytes, the pollen grains are carried passively inside water.
Choose the correct answer from the options given below:
What is the fate of a piece of DNA carrying only the gene of interest which is transferred into an alien organism?
Given below are two statements:
Statement I: Parenchyma is living, but collenchyma is dead tissue.
Statement II: Gymnosperms lack xylem vessels, but the presence of xylem vessels is the characteristic of angiosperms.
In the light of the above statements, choose the correct answer from the options given below:
Formation of interfascicular cambium from fully developed parenchyma cells is an example of
Which one of the following is not a criterion for classification of fungi?
The cofactor of the enzyme carboxypeptidase is:
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. CO₂
D. ATP
E. NADPH
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
The lactose present in the growth medium of bacteria is transported to the cell by the action of
The equation of Verhulst-Pearl logistic growth is \[ \frac{dN}{dt} = rN \left( 1 - \frac{N}{K} \right) \]
From this equation, \( K \) indicates:
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
The type of conservation in which the threatened species are taken out from their natural habitat and placed in special settings where they can be protected and given special care is called
Identify the type of flowers based on the position of calyx, corolla, and androecium with respect to the ovary from the given figures (a) and (b)
Given below are two statements:
Statement I: Bt toxins are insect group specific and coded by a gene cry IAc.
Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect, the inactive protoxin gets converted into the active form due to the acidic pH of the insect gut.
In the light of the above statements, choose the correct answer from the options given below:
Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
Given below are two statements:
Statement I: Chromosomes become gradually visible under light microscope during the leptotene stage.
Statement II: The beginning of the diplotene stage is recognized by the dissolution of the synaptonemal complex.
In the light of the above statements, choose the correct answer from the options given below:
Identify the part of the seed from the given figure which is destined to form the root when the seed germinates.
In the given figure, which component has thin outer walls and highly thickened inner walls?
Match List-I with List-II
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Spraying sugarcane crop with which of the following plant growth regulators increases the length of stem, thus, increasing the yield?
Match List I with List II
Choose the correct answer from the options given below:
In an ecosystem, if the Net Primary Productivity (NPP) of the first trophic level is 100x (kcal m–2 yr–1), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
Which of the following are fused in somatic hybridization involving two varieties of plants?
Match List I with List II
Choose the correct answer from the options given below:
Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.
Choose the correct answer from the options given below:
Which of the following statement is correct regarding the process of replication in E. coli?
The DNA present in chloroplast is:
Identify the correct description about the given figure:
Given below are two statements:
Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.
Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.
In the light of the above statements, choose the correct answer from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:
Name of muscle/location
Following are the stages of the pathway for conduction of an action potential through the heart:
A. AV bundle \quad B. Purkinje fibres \quad C. AV node \quad D. Bundle branches \quad E. SA node
Choose the correct sequence of the pathway from the options given below:
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
Which of the following statements is incorrect?
Which one is the correct product of DNA-dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
Match List I with List II

Choose the correct answer from the options given below:
Which of the following are Autoimmune disorders?
A. Myasthenia gravis
B. Rheumatoid arthritis
C. Gout
D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are two statements:
Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.
Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.
In the light of the above statements, choose the correct answer from the options given below:
Match List I with List
II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Following are the stages of cell division:
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
The flippers of the Penguins and Dolphins are the example of:
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.
Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.
In the light of the above statements, choose the most appropriate answer from the options given below:
Which of the following is not a component of the Fallopian tube?
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)
A. Homo habilis
B. Homo sapiens
C. Homo neanderthalensis
D. Homo erectus
Choose the correct sequence of human evolution from the options given below:
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
In the light of the above statements, choose the correct answer from the options given below:
Which of the following is not a steroid hormone?
Consider the following statements:
A. Annelids are true coelomates.
B. Poriferans are pseudocoelomates.
C. Aschelminthes are acoelomates.
D. Platyhelminthes are pseudocoelomates.
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:
Match List I with List II:
Choose the correct answer from the options given below:
The “Ti plasmid” of Agrobacterium tumefaciens stands for:
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: The presence or absence of hymen is not a reliable indicator of virginity.
Reason R: The hymen is torn during the first coitus only.
In the light of the above statements, choose the correct answer from the options given below:
The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:
Which of the following is not a natural/traditional contraceptive method?
Match List I with List II:
Choose the correct answer from the options given below:
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
Given below are two statements:
Statement I: Mitochondria and chloroplasts both are double-membrane bound organelles.
Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.
In the light of the above statements, choose the most appropriate answer from the options given below:
Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.
In the light of the above statements, choose the correct answer from the options given below:
Regarding catalytic cycle of an enzyme action, select the correct sequential steps:
A. Substrate-enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to active site.
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are two statements:
Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
Match List I with List II related to digestive system of cockroach:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are two statements:
Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.
Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.
In the light of the above statements, choose the most appropriate answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Choose the correct statement given below regarding juxta medullary nephron:
As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be:
The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post anal tail is absent.
Choose the most appropriate answer from the options given below:
NEET Previous Year Question Papers with Answer Keys
| NEET 2023 Question Papers | NEET 2022 Question Papers | NEET 2021 Question Papers |
| NEET 2020 Question Papers | NEET 2019 Question Papers | NEET 2018 Question Papers |








Comments