NEET 2024 Question Paper with Answers and Solutions PDF S1 in English

NEET 2024 Questions with Solutions Set S1
 

Question 1:
A bob is whirled in a horizontal plane by means of a string with an initial speed of \( \omega \) rpm. The tension in the string is \( T \). If speed becomes \( 2\omega \) while keeping the same radius, the tension in the string becomes:

• (1) \( \sqrt{2}T \)
• (2) \( T \)
• (3) \( 4T \)
• (4) \( \frac{T}{4} \)

A wire of length \( l \) and resistance \( 100 \Omega \) is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

• (1) \( 60 \Omega \)
• (2) \( 26 \Omega \)
• (3) \( 52 \Omega \)
• (4) \( 55 \Omega \)

A thermodynamic system is taken through the cycle \( abcd \). The work done by the gas along the path \( bc \) is:

• (1) \( -60 J \)
• (2) \( 0 \)
• (3) \( 30 J \)
• (4) \( -90 J \)

A logic circuit provides the output \( Y \) as per the following truth table:






The expression for the output \( Y \) is:

• (1) \( A \bar{B} + A \)
• (2) \( A \bar{B} \)
• (3) \( B \bar{A} \)
• (4) \( B \)

The graph which shows the variation of \( \frac{1}{\lambda^2} \) and its kinetic energy \( E \) (where \( \lambda \) is de Broglie wavelength of a free particle):

If the velocity of light in free space, the correct statements about photon among the following are:

A. The energy of a photon is \( E = h \nu \).

B. The velocity of a photon is \( c \).

C. The momentum of a photon, \( p = \frac{h\nu}{c} \).

D. In a photon-electron collision, both total energy and total momentum are conserved.

E. Photons possess positive charge.

Choose the correct answer from the options given below:

• (1) A and B only
• (2) A, B, and C only
• (3) A, B, C, and D only
• (4) A, C, and D only

The mass of a planet is \( \frac{1}{10} \)th that of the earth and its diameter is half that of the earth. The acceleration due to gravity of that planet is:

• (1) \( 39.2 \, m/s^2 \)
• (2) \( 19.6 \, m/s^2 \)
• (3) \( 9.8 \, m/s^2 \)
• (4) \( 4.9 \, m/s^2 \)

In a vernier calipers, \( (N + 1) \) divisions of vernier scale coincide with \( N \) divisions of main scale. If 1 MSD represents 0.1 cm, the vernier constant (in cm) is:

• (1) \( 10N + 1 \)
• (2) \( \frac{1}{10N} \)
• (3) \( \frac{1}{100(N+1)} \)
• (4) \( 100N \)

In an ideal transformer, the turns ratio is \( \frac{N_P}{N_S} = \frac{1}{2} \). The ratio \( V_S : V_P \) is equal to (the symbols carry their usual meaning):

• (1) \( 1:4 \)
• (2) \( 1:2 \)
• (3) \( 2:1 \)
• (4) \( 1:1 \)

At any instant of time \( t \), the displacement of any particle is given by \( 2t - 1 \) (SI unit) under the influence of force of 5 N. The value of instantaneous power is (in SI unit):

• (1) \( 6 \)
• (2) \( 10 \)
• (3) \( 5 \)
• (4) \( 7 \)

A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is \( 0.07 \) N/m, then the excess force required to take it away from the surface is:

• (1) \( 99 \) N
• (2) \( 19.8 \) N
• (3) \( 198 \) N
• (4) \( 19.8 \) mN

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is \( v \) in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)?

• (1) Point P has zero speed
• (2) Point P moves slower than point Q
• (3) Point P moves faster than point Q
• (4) Both the points P and Q move with equal speed

Given below are two statements: one is labelled as Assertion A, and the other is labelled as Reason R.

Assertion A: The potential \( V \) at any axial point, at \( 2 \) m distance (\( r \)) from the centre of the dipole of dipole moment vector \( P \) of magnitude \( 4 \times 10^{-6} \) C·m is \( 1.8 \times 10^{3} \) V.


Reason R: \( V = \frac{2P}{4\pi \epsilon_0 r^2} \), where \( r \) is the distance of any axial point, situated at \( 2 \) m from the centre of the dipole.

Choose the correct answer from the options given below:

• (1) A is false but R is true.
• (2) Both A and R are true, and R is the correct explanation of A.
• (3) Both A and R are true, but R is NOT the correct explanation of A.
• (4) A is true, but R is false.

If \( x = 5 \sin \left( \pi t + \frac{\pi}{3} \right) \) represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are:

• (1) \( 5 \) m, \( 1 \) s
• (2) \( 5 \) cm, \( 2 \) s
• (3) \( 5 \) m, \( 2 \) s
• (4) \( 5 \) cm, \( 1 \) s

An unpolarized light beam strikes a glass surface at Brewster’s angle. Then:

• (1) The reflected light will be completely polarized, but the refracted light will be partially polarized.
• (2) The reflected light will be partially polarized.
• (3) The refracted light will be completely polarized.
• (4) Both the reflected and refracted light will be completely polarized.

The quantities which have the same dimensions as those of solid angle are:

• (1) Angular speed and stress
• (2) Strain and angle
• (3) Strain and stress
• (4) Angle and stress

In a uniform magnetic field of 0.049 T, a magnetized needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is \( 9.8 \times 10^{-6} \) kg·m\(^2\). If the magnitude of magnetic moment of the needle is \( x \times 10^{-4} \) Am\(^2\), then the value of \( x \) is:

• (1) \( 128\pi^2 \)
• (2) \( 128\pi \)
• (3) \( 64\pi^2 \)
• (4) \( 50\pi^2 \)

A thin spherical shell is charged by some source. The potential difference between the two points C and P ( in V) shown in the figure is:

• (1) \( Zero \)
• (2) \( 3 \times 10^5 \)
• (3) \( 1 \times 10^5 \)
• (4) \( 0.5 \times 10^5 \)

The moment of inertia of a thin rod about an axis passing through its mid-point and perpendicular to the rod is \( 240 \) gm·cm\(^2\). Then the length of the \( 400 \) g rod is nearly:

• (1) \( 17.2 \) cm
• (2) \( 8.5 \) cm
• (3) \( 22.0 \) cm
• (4) \( 24.7 \) cm

Given below are two statements:

Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.

Statement II: Atoms of each element are stable and emit their characteristic spectrum.


In the light of the above statements, choose the \textit{most appropriate answer from the options given below:

• (1) Statement I is incorrect but Statement II is correct
• (2) Both Statement I and Statement II are correct
• (3) Both Statement I and Statement II are incorrect
• (4) Statement I is correct but Statement II is incorrect

Match List I with List II.


\begin{tabular{|c|c|
\hline
List I (Spectral Lines of Hydrogen for transitions from) & List II (Wavelengths in nm)

\hline
A. \( n = 3 \) to \( n = 2 \) & I. 410.2

B. \( n = 4 \) to \( n = 2 \) & II. 434.1

C. \( n = 5 \) to \( n = 2 \) & III. 656.3

D. \( n = 6 \) to \( n = 2 \) & IV. 486.1

\hline
\end{tabular

• (1) A-II, B-III, C-IV, D-I
• (2) A-III, B-II, C-I, D-IV
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-II, C-III, D-I

Match List I with List II.

\begin{table[h]
\centering
\renewcommand{\arraystretch{1.5
\setlength{\arrayrulewidth{0.8pt
\begin{tabular{|c|c|c|c|
\hline
\multicolumn{2{|c|{List-I (Material) & \multicolumn{2{c|{List-II (Susceptibility (\(\chi\)) )

\hline
A & Diamagnetic & I & \( \chi = 0 \)

B & Ferromagnetic & II & \( 0 > \chi \geq -1 \)

C & Paramagnetic & III & \( \chi \gg 1 \)

D & Non-magnetic & IV & \( 0 < \chi < \epsilon \) (a small positive number)

\hline
\end{tabular
\end{table



Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-II, D-I
• (2) A-II, B-III, C-IV, D-I
• (3) A-II, B-I, C-III, D-IV
• (4) A-III, B-II, C-I, D-IV

Consider the following statements A and B and identify the correct answer:





A. For a solar cell, the I-V characteristics lies in the IV quadrant of the graph.

B. In a reverse biased p-n junction diode, the current measured in \( \mu A \) is due to majority charge carriers.

• (1) Both A and B are incorrect
• (2) A is correct but B is incorrect
• (3) Both A and B are correct
• (4) A is incorrect but B is correct

If the monochromatic source in Young’s double-slit experiment is replaced by white light, then:

• (1) All bright fringes will be of equal width
• (2) The interference pattern will disappear
• (3) There will be a central dark fringe surrounded by a few colored fringes
• (4) There will be a central bright white fringe surrounded by a few colored fringes

A light ray enters through a right-angle prism at point P with the angle of incidence \( 30^\circ \) as shown in the figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the prism is:

• (1) \( \frac{\sqrt{2}}{2} \)
• (2) \( \frac{\sqrt{5}}{2} \)
• (3) \( \sqrt{5} \)
• (4) \( \frac{\sqrt{3}}{2} \)

The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 \( \Omega \), when connected through an external resistance of 4 \( \Omega \) as shown in the figure is:

• (1) \( 10 V \)
• (2) \( 4 V \)
• (3) \( 6 V \)
• (4) \( 8 V \)

A horizontal force 10 N is applied to a block A as shown in the figure. The masses of blocks A and B are 2 kg and 3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is:

• (1) \( 10 N \)
• (2) \( 4 N \)
• (3) \( 6 N \)
• (4) \( 0 \)

Two bodies A and B of same mass undergo completely inelastic one-dimensional collision. The body A moves with velocity \( v \), while body B is at rest before collision. The velocity of the system after collision is \( v' \). The ratio \( v : v' \) is:

• (1) \( 1:4 \)
• (2) \( 1:2 \)
• (3) \( 2:1 \)
• (4) \( 4:1 \)

The output \( Y \) of the given logic gate is similar to the output of an/a:

• (1) AND gate
• (2) NAND gate
• (3) NOR gate
• (4) OR gate

In the following circuit, the equivalent capacitance between terminal A and terminal B is:

• (1) \( 4 \mu F \)
• (2) \( 2 \mu F \)
• (3) \( 1 \mu F \)
• (4) \( 0.5 \mu F \)

A particle moving with uniform speed in a circular path maintains:

• (1) Varying velocity and varying acceleration
• (2) Constant velocity and varying acceleration
• (3) Constant acceleration
• (4) Constant velocity but varying acceleration

The maximum elongation of a steel wire of length 1 m if the elastic limit of steel and its Young’s modulus, respectively, are \( 8 \times 10^8 \) N/m\(^2\) and \( 2 \times 10^{11} \) N/m\(^2\) is:

• (1) \( 2 \) mm
• (2) \( 4 \) mm
• (3) \( 8 \) mm
• (4) \( 44 \) mm

\begin{array{c
^{290_{82X \xrightarrow{\alpha Y \xrightarrow{e^+ Z \xrightarrow{\beta^- P \xrightarrow{e^- Q
\end{array

In the nuclear emission stated above, the mass number and atomic number of the product (\( Q \)), respectively, are:

• (1) \( 286, 81 \)
• (2) \( 280, 81 \)
• (3) \( 286, 80 \)
• (4) \( 288, 82 \)

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and in solenoid-2, respectively, are through the directions:

• (1) BA and DC
• (2) AB and DC
• (3) BA and CD
• (4) AB and CD

A long wire of 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the center of the coil is (Take permeability of free space as \( 4\pi \times 10^{-7} \) SI units):

• (1) \( 44 \) mT
• (2) \( 40 \) mT
• (3) \( 47 \) mT
• (4) \( 44.7 \) mT

The property which is not of an electromagnetic wave traveling in free space is that:

• (1) They originate from charges moving with uniform speed
• (2) They are transverse in nature
• (3) The energy density in electric field is equal to energy density in magnetic field
• (4) They travel with a speed equal to \( \frac{1}{\sqrt{\mu_0 \epsilon_0}} \)

The velocity (V) – time (t) plot of the motion of a body is shown below:




The acceleration (a) – time (t) graph that best suits this motion is:

A \( 10 \mu F \) capacitor is connected to a \( 210 V, 50 Hz \) source as shown in the figure. The peak current in the circuit is nearly \((\pi = 3.14)\):

• (1) \( 0.35 A \)
• (2) \( 0.58 A \)
• (3) \( 0.93 A \)
• (4) \( 1.20 A \)

The following graph represents the \( T \)-\( V \) curves of an ideal gas (where \( T \) is the temperature and \( V \) the volume) at three pressures \( P_1, P_2 \) and \( P_3 \) compared with those of Charles’s law represented as dotted lines.





Then the correct relation is:

• (1) \( P_1 > P_2 > P_3 \)
• (2) \( P_3 > P_2 > P_1 \)
• (3) \( P_1 > P_3 > P_2 \)
• (4) \( P_2 > P_1 > P_3 \)

Choose the correct circuit which can achieve the bridge balance.

Two heaters A and B have power ratings of 1 kW and 2 kW, respectively. These two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

• (1) \( 2:3 \)
• (2) \( 1:1 \)
• (3) \( 2:9 \)
• (4) \( 1:2 \)

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then:


A. The charge stored in it increases.
B. The energy stored in it decreases.
C. Its capacitance increases.
D. The ratio of charge to its potential remains the same.
E. The product of charge and voltage increases.


Choose the most appropriate answer from the options given below:

• (1) A, B, and C only
• (2) A, B, and E only
• (3) A, C, and E only
• (4) B, D, and E only

A force defined by \( F = \alpha t + \beta t \) acts on a particle at a given time \( t \). The factor which is dimensionless, if \( \alpha \) and \( \beta \) are constants, is:

• (1) \( \frac{\alpha \beta}{t} \)
• (2) \( \frac{\beta t}{\alpha} \)
• (3) \( \frac{\alpha t}{\beta} \)
• (4) \( \alpha \beta t \)

The minimum energy required to launch a satellite of mass \( m \) from the surface of Earth (mass \( M \), radius \( R \)) into a circular orbit at an altitude of \( 2R \) from the surface of the Earth is:

• (1) \( \frac{GmM}{3R} \)
• (2) \( \frac{5GmM}{6R} \)
• (3) \( \frac{2GmM}{3R} \)
• (4) \( \frac{GmM}{2R} \)

A metallic bar of Young’s modulus, \( 0.5 \times 10^{11} \) N/m\(^2\) and coefficient of linear thermal expansion \( 10^{-5} \) °C\(^{-1}\), length \( 1 \) m and area of cross-section \( 10^{-3} \) m\(^2\) is heated from \( 0^\circ C \) to \( 100^\circ C \) without expansion or bending. The compressive force developed in it is:

• (1) \( 2 \times 10^3 \) N
• (2) \( 5 \times 10^3 \) N
• (3) \( 50 \times 10^3 \) N
• (4) \( 100 \times 10^3 \) N

A parallel plate capacitor is charged by connecting it to a battery through a resistor. If \( I \) is the current in the circuit, then the gap between the plates:

• (1) Displacement current of magnitude greater than \( I \) flows but can be in any direction
• (2) There is no displacement current
• (3) Displacement current of magnitude equal to \( I \) flows in the same direction as \( I \)
• (4) Displacement current of magnitude equal to \( I \) flows in a direction opposite to that of \( I \)

A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:


A. Hold the sheet there if it is magnetic.
B. Hold the sheet there if it is non-magnetic.
C. Move the sheet away from the pole with uniform velocity if it is conducting.
D. Move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.


Choose the correct statement(s) from the options given below:

• (1) C only
• (2) B and D only
• (3) A and C only
• (4) A, C, and D only

If the mass of the bob in a simple pendulum is increased to three times its original mass and its length is made half its original length, then the new time period of oscillation is \( x \) times its original time period. The value of \( x \) is:

• (1) \( 4 \)
• (2) \( \sqrt{3} \)
• (3) \( \sqrt{2} \)
• (4) \( \frac{2}{\sqrt{3}} \)

An iron bar of length \( L \) has magnetic moment \( M \). It is bent at the middle of its length such that the two arms make an angle \( 60^\circ \) with each other. The magnetic moment of this new magnet is:

• (1) \( \frac{M}{\sqrt{3}} \)
• (2) \( M \)
• (3) \( \frac{M}{2} \)
• (4) \( 2M \)

A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of the telescope for viewing a distant object is:

• (1) \( 32 \)
• (2) \( 34 \)
• (3) \( 28 \)
• (4) \( 17 \)

Identify the correct reagents that would bring about the following transformation:

• (1) (i) \( H_3O^+ \)
  \hspace{0.5cm} (ii) PCC
• (2) (i) \( H_3O^+ \)
  \hspace{0.5cm} (ii) \( CrO_3 \)
• (3) (i) \( Br_2 \)
  \hspace{0.5cm} (ii) \( H_2O_2/OH^- \)
• (4) (i) \( H_2O_2/OH^- \)
  \hspace{0.5cm} (ii) \( alk. KMnO_4 \)

The compound that will undergo S\(_N1\) reaction with the fastest rate is:

Match List I with List II.


\begin{tabular{|c|l|c|l|
\hline
List I (Molecule) & & List II (Number and types of bond/s between two carbon atoms) &

\hline
A. & Ethane & I. & One \(\sigma\)-bond and two \(\pi\)-bonds

B. & Ethene & II. & Two \(\pi\)-bonds

C. & Carbon molecule, C\(_2\) & III. & One \(\sigma\)-bond

D. & Ethyne & IV. & One \(\sigma\)-bond and one \(\pi\)-bond

\hline
\end{tabular



Choose the correct answer from the options given below:

• (1) A-III, B-V, C-II, D-I
• (2) A-I, B-IV, C-II, D-III
• (3) A-IV, B-III, C-II, D-I
• (4) A-III, B-IV, C-II, D-I

Given below are two statements:

Statement I: Both \([ Co(NH_3)_6 ]^{3+}\) and \([ CoF_6 ]^{3-}\) complexes are octahedral but differ in their magnetic behavior.

Statement II: \([ Co(NH_3)_6 ]^{3+}\) is diamagnetic whereas \([ CoF_6 ]^{3-}\) is paramagnetic.

Choose the correct answer from the options given below:

• (1) Statement I is false but Statement II is true
• (2) Both Statement I and Statement II are true
• (3) Both Statement I and Statement II are false
• (4) Statement I is true but Statement II is false

Match List I with List II.


\renewcommand{\arraystretch{1.2
\begin{tabular{|c|l|c|l|
\hline
List I (Compound) & & List II (Shape/geometry) &

\hline
A. & NH\(_3\) & I. & Trigonal Pyramidal

B. & BrF\(_5\) & II. & Square Planar

C. & XeF\(_4\) & III. & Octahedral

D. & SF\(_6\) & IV. & Square Pyramidal

\hline
\end{tabular


Choose the correct answer from the options given below:

• (1) A-II, B-III, C-V, D-I
• (2) A-I, B-V, C-II, D-III
• (3) A-II, B-IV, C-III, D-I
• (4) A-III, B-IV, C-I, D-II

Arrange the following elements in increasing order of first ionization enthalpy:
\[ Li, Be, B, C, N \]

• (1) \( Li < Be < N < B < C \)
• (2) \( Li < Be < B < C < N \)
• (3) \( Li < B < Be < C < N \)
• (4) \( Li < Be < C < B < N \)

The reagents with which glucose does not react to give the corresponding tests/products are:


A. Tollen’s reagent
B. Schiff’s reagent
C. HCN
D. NH\(_2\)OH
E. NaHSO\(_3\)


Choose the correct options from the given below:

• (1) E and C
• (2) B and C
• (3) A and D
• (4) B and E

Match List I with List II.


\renewcommand{\arraystretch{1.2
\begin{tabular{|c|l|c|l|
\hline
List I (Quantum Number) & & List II (Information provided) &

\hline
A. & \( m_l \) & I. & Shape of orbital

B. & \( m_s \) & II. & Size of orbital

C. & \( l \) & III. & Orientation of orbital

D. & \( n \) & IV. & Orientation of spin of electron

\hline
\end{tabular



Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-I, B-III, C-II, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-III, B-IV, C-I, D-I

The highest number of helium atoms is in:

• (1) 2.271098 L of helium at STP
• (2) 4 mol of helium
• (3) 4 u of helium
• (4) 4 g of helium

Which reaction is NOT a redox reaction?

• (1) \( BaCl_2 + Na_2SO_4 \rightarrow BaSO_4 + 2NaCl \)
• (2) \( Zn + CuSO_4 \rightarrow ZnSO_4 + Cu \)
• (3) \( 2KClO_3 \rightarrow 2KCl + 3O_2 \)
• (4) \( H_2 + Cl_2 \rightarrow 2HCl \)

Given below are two statements:

Statement I: The boiling point of hydrides of Group 16 elements follows the order \[ H_2O > H_2Te > H_2Se > H_2S. \]

Statement II: On the basis of molecular mass, \( H_2O \) is expected to have a lower boiling point than the other members of the group, but due to the presence of extensive **hydrogen bonding** in \( H_2O \), it has a **higher boiling point**.

Choose the correct answer from the options given below:

• (1) Statement I is false but Statement II is true
• (2) Both Statement I and Statement II are true
• (3) Both Statement I and Statement II are false
• (4) Statement I is true but Statement II is false

Arrange the following elements in increasing order of electronegativity:
\[ N, O, F, C, Si \]

• (1) \( F < O < N < C < Si \)
• (2) \( Si < C < N < O < F \)
• (3) \( Si < C < O < N < F \)
• (4) \( O < F < N < C < Si \)

Match List I with List II.


\renewcommand{\arraystretch{1.2
\begin{tabular{|c|l|c|l|
\hline
List I (Process) & & List II (Conditions) &

\hline
A. & Isothermal process & II. & Carried out at constant temperature

B. & Isochoric process & III. & Carried out at constant volume

C. & Isobaric process & IV. & Carried out at constant pressure

D. & Adiabatic process & I. & No heat exchange

\hline
\end{tabular


Choose the correct answer from the options given below:

• (1) A-II, B-III, C-IV, D-I
• (2) A-IV, B-III, C-II, D-I
• (3) A-IV, B-II, C-III, D-I
• (4) A-I, B-II, C-III, D-IV

The energy of an electron in the ground state (n = 1) for He\(^{+}\) ion is \(-x\) J, then that for an electron in the ground state for Be\(^{3+}\) ion in J is

• (1) \(\frac{4}{9} x\)
• (2) \(-4x\)
• (3) \(\frac{x}{9}\)
• (4) \(-x\)

Match List I with List II.


\renewcommand{\arraystretch{0.2
\begin{tabular{|c|l|c|l|
\hline
List I (Conversion) & & List II (Number of Faraday required) &

\hline
A. & 1 mol of H\(_2\)O to O\(_2\) & II. & 2F

B. & 1 mol of MnO\(_4^-\) to Mn\(^{2+}\) & IV. & 5F

C. & 1.5 mol of Ca from molten CaCl\(_2\) & III. & 1F

D. & 1 mol of FeO to Fe\(_2\)O\(_3\) & I. & 3F

\hline
\end{tabular


Choose the correct answer from the options given below:

• (1) A-III, B-IV, C-II, D-I
• (2) A-II, B-IV, C-I, D-III
• (3) A-III, B-V, C-I, D-IV
• (4) A-II, B-III, C-I, D-IV

1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to

• (1) 200 mg
• (2) 750 mg
• (3) 250 mg
• (4) Zero mg

The most stable carbocation among the following is:

In which of the following equilibria, \( K_p \) and \( K_c \) are NOT equal?


\begin{array{ll
\text{(1) & 2\text{BrCl_{(g) \rightleftharpoons \text{Br_2{(g) + \text{Cl_2{(g)

\text{(2) & \text{PCl_5{(g) \rightleftharpoons \text{PCl_3{(g) + \text{Cl_2{(g)

\text{(3) & \text{H_2{(g) + \text{I_2{(g) \rightleftharpoons 2\text{HI{(g)

\text{(4) & \text{CO{(g) + \text{H_2\text{O{(g) \rightleftharpoons \text{CO_2{(g) + \text{H_2{(g)

\end{array

The E° value for the Mn³⁺/Mn²⁺ couple is more positive than that of Cr³⁺/Cr²⁺ or Fe³⁺/Fe²⁺ due to change of

• (1) d³ to d⁵ configuration
• (2) d⁵ to d⁴ configuration
• (3) d⁵ to d² configuration
• (4) d⁴ to d⁵ configuration

Fehling’s solution ‘A’ is

• (1) aqueous sodium citrate
• (2) aqueous copper sulphate
• (3) alkaline copper sulphate
• (4) alkaline solution of sodium potassium tartrate (Rochelle’s salt)

Match List I with List II.




Choose the correct answer from the options given below:

• (1) A-I, B-IV, C-II, D-III
• (2) A-IV, B-I, C-III, D-II
• (3) A-III, B-I, C-II, D-IV
• (4) A-IV, B-I, C-II, D-III

In which of the following processes entropy increases?

A. A liquid evaporates to vapour.

B. Temperature of a crystalline solid lowered from 130 K to 0 K.

C. 2NaHCO₃(s) → Na₂CO₃(s) + CO₂(g) + H₂O(g)

D. Cl₂(g) → 2Cl(g)

• (1) C and D
• (2) A and C
• (3) A, B and D
• (4) A, C and D

A compound with a molecular formula of C₆H₁₄ has two tertiary carbons. Its IUPAC name is:

• (1) 2,2-dimethylbutane
• (2) n-hexane
• (3) 2-methylpentane
• (4) 2,3-dimethylbutane

For the reaction \( 2A \rightleftharpoons B + C \), \( K_c = 4 \times 10^{-3} \). At a given time, the composition of reaction mixture is:
\[ [A] = [B] = [C] = 2 \times 10^{-3} \, M \]


Then, which of the following is correct?

• (1) Reaction has gone to completion in forward direction.
• (2) Reaction is at equilibrium.
• (3) Reaction has a tendency to go in forward direction.
• (4) Reaction has a tendency to go in backward direction.

Given below are two statements:
Statement I: The boiling point of three isomeric pentanes follows the order \( n-pentane > isopentane > neopentane \)


Statement II: When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Statement I is incorrect but Statement II is correct
• (2) Both Statement I and Statement II are correct
• (3) Both Statement I and Statement II are incorrect
• (4) Statement I is correct but Statement II is incorrect

Which one of the following alcohols reacts instantaneously with Lucas reagent?

The Henry's law constant (KH) values of three gases (A, B, C) in water are 145, 2 \times 10^{-5}, and 35 kbar, respectively. The solubility of these gases in water follow the order:


A > B > C
B > A > C
B > C > A
A > C > B

On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as

• (A) Chromatography
• (B) Crystallization
• (C) Sublimation
• (D) Distillation

Match List I with List II.

\begin{table[h!]
\centering
\renewcommand{\arraystretch{1.2
\begin{tabular{|c|l|c|l|
\hline
List I (Complex) & & List II (Type of isomerism) &

\hline
A. & \([Co(NH_3)_5(NO_2)]Cl_2\) & I. & Solvate isomerism

B. & \([Co(NH_3)_5(SO_4)]Br\) & II. & Linkage isomerism

C. & \([Co(NH_3)_6][Cr(CN)_6]\) & III. & Ionization isomerism

D. & \([Co(H_2O)_6]Cl_3\) & IV. & Coordination isomerism

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

• (A) A-II, B-III, C-IV, D-I
• (B) A-III, B-II, C-I, D-IV
• (C) A-II, B-III, C-I, D-IV
• (D) A-III, B-II, C-IV

Intramolecular hydrogen bonding is present in

Given below are two statements:

Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction.

Statement II: Aniline cannot be prepared through Gabriel synthesis.


In the light of the above statements, choose the correct answer from the options given below:

• (1) Statement I is incorrect but Statement II is true
• (2) Both Statement I and Statement II are true
• (3) Both Statement I and Statement II are false
• (4) Statement I is correct but Statement II is false

Among Group 16 elements, which one does NOT show -2 oxidation state?

• (1) Po
• (2) O
• (3) Se
• (4) Te

Activation energy of any chemical reaction can be calculated if one knows the value of

• (1) rate constant at two different temperatures
• (2) rate constant at standard temperature
• (3) probability of collision
• (4) orientation of reactant molecules during collision

'Spin only' magnetic moment is same for which of the following ions?

A. Ti³⁺

B. Cr²⁺

C. Mn²⁺

D. Fe²⁺

E. Sc³⁺

Choose the most appropriate answer from the options given below.

• (1) A and D only
• (2) B and D only
• (3) A and E only
• (4) B and C only

Which plot of ln k vs 1/T is consistent with Arrhenius equation?

Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.

A. Al\(^{3+}\)

B. Cu\(^{2+}\)

C. Ba\(^{2+}\)

D. Co\(^{2+}\)

E. Mg\(^{2+}\)


Choose the correct answer from the options given below.

• (1) E, A, B, C, D
• (2) B, A, D, C, E
• (3) B, C, A, D, E
• (4) E, C, D, B, A

The plot of osmotic pressure (\(\Pi\)) vs concentration (mol L\(^-1\)) for a solution gives a straight line with slope 25.73 L bar mol\(^-1\). The temperature at which the osmotic pressure measurement is done is

(Use R = 0.083 L bar mol\(^-1\) K\(^-1\))

• (1) 12.05\(^\circ\)C
• (2) 37\(^\circ\)C
• (3) 310\(^\circ\)C
• (4) 25.73\(^\circ\)C

Identify the correct answer.

• (1) Three canonical forms can be drawn for CO\(_2^{2-}\) ion
• (2) Three resonance structures can be drawn for ozone
• (3) BF\(_3\) has non-zero dipole moment
• (4) Dipole moment of NF\(_3\) is greater than that of NH\(_3\)

A compound X contains 32% of A, 20% of B and the remaining percentage of C. Then, the empirical formula of X is:

(Given atomic masses of A = 64; B = 40; C = 32)

• (1) ABC\(_4\)
• (2) A\(_2\)BC\(_2\)
• (3) ABC\(_3\)
• (4) AB\(_2\)C\(_2\)

Major products A and B formed in the following reaction sequence, are:




\label{fig:enter-label

Identify the major product C formed in the following reaction sequence:
\[ CH_3 - CH_2 - CH_2 - I \xrightarrow{NaCN} A \xrightarrow{OH^- (Partial hydrolysis)} B \xrightarrow{NaOH, Br_2} C (major) \]

\begin{array{ll

• (1) & \alpha-bromobutanoic acid
• (2) & propylamine
• (3) & butylamine
• (4) & butanamide
  \end{array}

Consider the following reaction in a sealed vessel with concentrations of
\[ N_2 = 3.0 \times 10^{-3} M, \quad NO = 4.2 \times 10^{-3} M, \quad N_2O = 2.8 \times 10^{-3} M \]
If 1 mol L\(^{-1}\) \(of NO_2\) is taken in a closed vessel, what will the degree of dissociation (\(\alpha\)) of NO at equilibrium?

• (1) 0.717
• (2) 0.00889
• (3) 0.0889
• (4) 0.8889

The products A and B obtained in the following reactions, respectively, are:
\[ 3ROH + PCl_3 \rightarrow 3RCl + A \]
\[ ROH + PCl_5 \rightarrow RCl + HCl + B \]



\begin{array{ll

• (1) & H_3PO_3 and PCl_3
• (2) & PCl_3 and H_3PO_3
• (3) & PCl_3 and H_3PO_4
• (4) & H_3PO_4 and PCl_3
  \end{array}

The pair of lanthanoid ions which are diamagnetic is

• (1) Pm\(^{3+}\) and Sm\(^{3+}\)
• (2) Ce\(^{4+}\) and Yb\(^{2+}\)
• (3) Ce\(^{3+}\) and Eu\(^{2+}\)
• (4) Gd\(^{3+}\) and Eu\(^{3+}\)

The rate of a reaction quadruples when temperature changes from 27\(^\circ\)C to 57\(^\circ\)C. Calculate the energy of activation.

(Given R = 8.314 J K\(^{-1}\) mol\(^{-1}\), log\(_4\) = 0.6021)




\begin{array{ll

• (1) & 3804 \, kJ/mol
• (2) & 38.04 \, kJ/mol
• (3) & 380.4 \, kJ/mol
• (4) & 3.80 \, kJ/mol
  \end{array}

For the given reaction:

During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe\(^{2+}\) ion?

• (1) dilute sulphuric acid
• (2) dilute hydrochloric acid
• (3) concentrated sulphuric acid
• (4) dilute nitric acid

The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is

(Given \(R = 2.0 \, cal mol^{-1} K^{-1}\))

• (1) 100 calories
• (2) 0 calorie
• (3) -413.14 calories
• (4) 413.14 calories

Given below are two statements:

Statement I: \([ Co(NH_3)_6]^{3+}\) is a homoleptic complex whereas \([ Co(NH_3)_5Cl]^{2+}\) is a heteroleptic complex.

Statement II: Complex \([ Co(NH_3)_6]^{3+}\) has only one kind of ligands but \([ Co(NH_3)_5Cl]^{2+}\) has more than one kind of ligands.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Statement I is false but Statement II is true
• (2) Both Statement I and Statement II are true
• (3) Both Statement I and Statement II are false
• (4) Statement I is true but Statement II is false

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given: Molar mass of Cu = 63 g/mol, F = 96487 C):

• (1) 0.0315 g
• (2) 3.15 g
• (3) 0.315 g
• (4) 31.5 g

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:




\begin{array{ll

• (1) & Carbohydrates
• (2) & Amino acids
• (3) & Phospholipids
• (4) & Glycerides
  \end{array}

These are regarded as major causes of biodiversity loss:

• (E) [A.] Over exploitation
• (F) [B.] Co-extinction
• (G) [C.] Mutation
• (H) [D.] Habitat loss and fragmentation
• (I) [E.] Migration \textbf{Choose the correct option:} \begin{array}{ll}
• (1) & A, B and D only
• (2) & A, C and D only
• (3) & A, B, C and D only
• (4) & A, B and E only
  \end{array}
• (J) \textbf{Over exploitation} (A) - The excessive use of species and natural resources leads to their depletion and extinction.
• (K) \textbf{Co-extinction} (B) - The extinction of one species can trigger the extinction of another species dependent on it.
• (L) \textbf{Habitat loss and fragmentation} (D) - Destruction of natural habitats due to deforestation, urbanization, and agriculture is a significant cause of biodiversity loss. Mutation (C) and Migration (E) are not primary causes of biodiversity loss.

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?


\begin{array{ll

• (1) & BB/Bb
• (2) & BB
• (3) & bb
• (4) & Bb
  \end{array}

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end:


\begin{array{ll

• (1) & Promoter, Structural gene, Terminator
• (2) & Repressor, Operator gene, Structural gene
• (3) & Structural gene, Transposons, Operator gene
• (4) & Inducer, Repressor, Structural gene
  \end{array}

Identify the set of correct statements:

• (M) The flowers of Vallisneria are colourful and produce nectar.
• (N) The flowers of water lily are not pollinated by water.
• (O) In most of water-pollinated species, the pollen grains are protected from wetting.
• (P) Pollen grains of some hydrophytes are long and ribbon-like.
• (Q) In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options given below: \begin{array}{ll}
• (1) & B, C, D and E only
• (2) & C, D and E only
• (3) & A, B, C and D only
• (4) & A, C, D and E only
  \end{array}

Bulliform cells are responsible for


\begin{array{ll

• (1) & Providing large spaces for storage of sugars.
• (2) & Inward curling of leaves in monocots.
• (3) & Protecting the plant from salt stress.
• (4) & Increased photosynthesis in monocots.
  \end{array}

Match List I with List II
\[ \begin{array}{|c|l|c|l|} \hline \textbf{List-I} & \textbf{Fungus} & \textbf{List-II} & \textbf{Type}
\hline A. & Rhizopus & I. & Mushroom
B. & Ustilago & II. & Smut fungus
C. & Puccinia & III. & Bread mould
D. & Agaricus & IV. & Rust fungus
\hline \end{array} \]

Choose the correct answer from the options given below:


\begin{array{ll

• (1) & A-IV, B-III, C-II, D-I
• (2) & A-III, B-II, C-IV, D-I
• (3) & A-I, B-III, C-II, D-IV
• (4) & A-III, B-II, C-I, D-IV
  \end{array}

Given below are two statements:

Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.

Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.


In the light of the above statements, choose the correct answer from the options given below:


\begin{array{ll

• (1) & Statement I is false but Statement II is true
• (2) & Both Statement I and Statement II are true
• (3) & Both Statement I and Statement II are false
• (4) & Statement I is true but Statement II is false
  \end{array}

Match List I with List II.
\[ \begin{array}{|c|l|c|l|} \hline \textbf{List I (Microorganism)} & & \textbf{List II (Product)} &
\hline A. & Clostridium butylicum & I. & Ethanol
B. & Saccharomyces cerevisiae & II. & Streptokinase
C. & Trichoderma polysporum & III. & Butyric acid
D. & Streptococcus sp. & IV. & Cyclosporin-A
\hline \end{array} \]

Choose the correct answer from the options given below:


\begin{array{ll

• (1) & A-IV, B-I, C-III, D-II
• (2) & A-III, B-I, C-II, D-IV
• (3) & A-II, B-IV, C-III, D-I
• (4) & A-III, B-I, C-IV, D-II
  \end{array}

The cofactor of the enzyme carboxypeptidase is:

\
\begin{array{ll

• (1) & Haem
• (2) & Zinc
• (3) & Niacin
• (4) & Flavin
  \end{array}

Given below are two statements:

Statement I: Parenchyma is living but collenchyma is dead tissue.

Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.

In the light of the above statements, choose the correct answer from the options given below:


\begin{array{ll

• (1) & Statement I is false but Statement II is true
• (2) & Both Statement I and Statement II are true
• (3) & Both Statement I and Statement II are false
• (4) & Statement I is true but Statement II is false
  \end{array}

Identify the type of flowers based on the position of calyx, corolla, and androecium with respect to the ovary from the given figures (a) and (b).






\begin{array{ll

• (1) & (a) Perigynous; (b) Perigynous
• (2) & (a) Epigynous; (b) Hypogynous
• (3) & (a) Hypogynous; (b) Epigynous
• (4) & (a) Perigynous; (b) Epigynous
  \end{array}

The equation of Verhulst-Pearl logistic growth is: \[ \frac{dN}{dt} = rN \left[ \frac{K - N}{K} \right]. \]
From this equation, K indicates:


\begin{array{ll

• (1) & Population density
• (2) & Intrinsic rate of natural increase
• (3) & Biotic potential
• (4) & Carrying capacity
  \end{array}

How many molecules of ATP and NADPH are required for every molecule of CO\(_2\) fixed in the Calvin cycle?


\begin{array{ll

• (1) & 3 molecules of ATP and 2 molecules of NADPH
• (2) & 2 molecules of ATP and 3 molecules of NADPH
• (3) & 2 molecules of ATP and 2 molecules of NADPH
• (4) & 3 molecules of ATP and 3 molecules of NADPH
  \end{array}

Which of the following are required for the dark reaction of photosynthesis?


\begin{array{ll
\text{A. & \text{Light

\text{B. & \text{Chlorophyll

\text{C. & \text{CO_2

\text{D. & \text{ATP

\text{E. & \text{NADPH

\end{array


Choose the correct answer from the options given below:


\begin{array{ll

• (1) & D and E only
• (2) & A, B and C only
• (3) & B, C and D only
• (4) & C, D and E only
  \end{array}

What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?
\[ \begin{array}{ll} A. & The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
B. & It may get integrated into the genome of the recipient.
C. & It may multiply and be inherited along with the host DNA.
D. & The alien piece of DNA is not an integral part of chromosome.
E. & It shows ability to replicate.
\end{array} \]

Choose the correct answer from the options given below:


\begin{array{ll

• (1) & A and E only
• (2) & A and B only
• (3) & D and E only
• (4) & B and C only
  \end{array}

Formation of interfascicular cambium from fully developed parenchyma cells is an example for:


\begin{array{ll

• (1) & Maturation
• (2) & Differentiation
• (3) & Redifferentiation
• (4) & Dedifferentiation
  \end{array}

The type of conservation in which the threatened species are taken out from their natural habitat and placed in a special setting where they can be protected and given special care is called:


\begin{array{ll

• (1) & Sustainable development
• (2) & in-situ conservation
• (3) & Biodiversity conservation
• (4) & Semi-conservative method
  \end{array}

Which of the following is an example of an actinomorphic flower?


\begin{array{ll

• (1) & Sesbania
• (2) & Datura
• (3) & Cassia
• (4) & Pisum
  \end{array}

The capacity to generate a whole plant from any cell of the plant is called:


\begin{array{ll

• (1) & Somatic hybridization
• (2) & Totipotency
• (3) & Micropropagation
• (4) & Differentiation
  \end{array}

Which one of the following can be explained on the basis of Mendel's Law of Dominance?
\[ \begin{array}{ll} \textbf{A.} & Out of one pair of factors one is dominant and the other is recessive.
\textbf{B.} & Alleles do not show any expression and both the characters appear as such in F\(_2\) generation.
\textbf{C.} & Factors occur in pairs in normal diploid plants.
\textbf{D.} & The discrete unit controlling a particular character is called factor.
\textbf{E.} & The expression of only one of the parental characters is found in a monohybrid cross.
\end{array} \]



\begin{array{ll

• (1) & A, B, C, D and E
• (2) & A, B and C only
• (3) & A, C, D and E only
• (4) & B, C and D only
  \end{array}

Spindle fibers attach to kinetochores of chromosomes during


\begin{array{ll

• (1) & Telophase
• (2) & Prophase
• (3) & Metaphase
• (4) & Anaphase
  \end{array}

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:


\begin{array{ll

• (1) & Enzyme activation
• (2) & Cofactor inhibition
• (3) & Feedback inhibition
• (4) & Competitive inhibition
  \end{array}

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:


\begin{array{ll

• (1) & 10 bp
• (2) & 8 bp
• (3) & 6 bp
• (4) & 4 bp
  \end{array}

Given below are two statements:

Statement I: Bt toxins are insect group specific and coded by a gene \textit{cry IAc.


Statement II: Bt toxin exists as inactive protoxin in \textit{B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut.

In the light of the above statements, choose the correct answer from the options given below:


\begin{array{ll

• (1) & Statement I is false but Statement II is true
• (2) & Both Statement I and Statement II are true
• (3) & Both Statement I and Statement II are false
• (4) & Statement I is true but Statement II is false
  \end{array}

Match List I with List II.
\[ \begin{array}{|c|l|c|l|} \hline \textbf{List-I} & \textbf{ } & \textbf{List-II} & \textbf{ }
\hline \textbf{A.} & Nucleolus & \textbf{I.} & Site of formation of glycolipid
\textbf{B.} & Centriole & \textbf{II.} & Organization like the cartwheel
\textbf{C.} & Leucoplasts & \textbf{III.} & Site for active ribosomal RNA synthesis
\textbf{D.} & Golgi apparatus & \textbf{IV.} & For storing nutrients
\hline \end{array} \]


Choose the correct answer from the options given below:


\begin{array{ll

• (1) & A-I, B-II, C-III, D-IV
• (2) & A-III, B-II, C-IV, D-I
• (3) & A-II, B-I, C-III, D-IV
• (4) & A-III, B-IV, C-II, D-I
  \end{array}

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?




\begin{array{ll

• (1) & Red, Pink as well as white flowered plants
• (2) & Only red flowered plants
• (3) & Red flowered as well as pink flowered plants
• (4) & Only pink flowered plants
  \end{array}

List of endangered species was released by




\begin{array{ll

• (1) & IUCN
• (2) & GEAC
• (3) & WWF
• (4) & FOAM
  \end{array}

Tropical regions show greatest level of species richness because



[A.] Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.
[B.] Tropical environments are more seasonal.
[C.] More solar energy is available in tropics.
[D.] Constant environments promote niche specialization.
[E.] Tropical environments are constant and predictable.


Choose the correct answer from the options given below:


\begin{array{ll

• (1) & A, B and D only
• (2) & A, C, D and E only
• (3) & A and B only
• (4) & A, B and E only
  \end{array}

Which one of the following is not a criterion for classification of fungi?



\begin{array{ll

• (1) & Fruiting body
• (2) & Morphology of mycelium
• (3) & Mode of nutrition
• (4) & Mode of spore formation
  \end{array}

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.






\begin{array{ll

• (1) & D
• (2) & A
• (3) & B
• (4) & C
  \end{array}

The lactose present in the growth medium of bacteria is transported to the cell by the action of:



\begin{array{ll

• (1) & Polymerase
• (2) & Beta-galactosidase
• (3) & Acetylase
• (4) & Permease
  \end{array}

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin:



\begin{array{ll

• (1) & can help in cell division in grasses, to produce growth.
• (2) & promotes apical dominance.
• (3) & promotes abscission of mature leaves only.
• (4) & does not affect mature monocotyledonous plants.
  \end{array}

In the given figure, which component has thin outer walls and highly thickened inner walls?






\begin{array{ll

• (1) & B
• (2) & C
• (3) & D
• (4) & A
  \end{array}

Match List I with List II.
\[ \begin{array}{|c|l|c|l|} \hline \multicolumn{2}{|c|}{\textbf{List I}} & \multicolumn{2}{|c|}{\textbf{List II}}
\hline \textbf{A.} & Two or more alternative forms of a gene & \textbf{I.} & Back cross
\textbf{B.} & Cross of F\(_1\) progeny with homozygous recessive parent & \textbf{II.} & Ploidy
\textbf{C.} & Cross of F\(_1\) progeny with any of the parents & \textbf{III.} & Allele
\textbf{D.} & Number of chromosome sets in plant & \textbf{IV.} & Test cross
\hline \end{array} \]



\begin{array{ll

• (1) & A-IV, B-III, C-II, D-I
• (2) & A-I, B-II, C-III, D-IV
• (3) & A-II, B-I, C-III, D-IV
• (4) & A-III, B-IV, C-I, D-II
  \end{array}

Match List I with List II.
\[ \begin{array}{|c|l|c|l|} \hline \multicolumn{2}{|c|}{\textbf{List I}} & \multicolumn{2}{|c|}{\textbf{List II}}
\hline \textbf{A.} & Rose & \textbf{I.} & Twisted aestivation
\textbf{B.} & Pea & \textbf{II.} & Perigynous flower
\textbf{C.} & Cotton & \textbf{III.} & Drupe
\textbf{D.} & Mango & \textbf{IV.} & Marginal placentation
\hline \end{array} \]



\begin{array{ll

• (1) & A-II, B-III, C-IV, D-I
• (2) & A-II, B-IV, C-I, D-III
• (3) & A-I, B-II, C-III, D-IV
• (4) & A-IV, B-III, C-II, D-I
  \end{array}

Given below are two statements:

Statement I: In C\textsubscript{3 plants, some O\textsubscript{2 binds to RuBisCO, hence CO\textsubscript{2 fixation is decreased.

Statement II: In C\textsubscript{4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

In the light of the above statements, choose the correct answer from the options given below:


\begin{array{ll

• (1) & Statement I is false but Statement II is true
• (2) & Both Statement I and Statement II are true
• (3) & Both Statement I and Statement II are false
• (4) & Statement I is true but Statement II is false
  \end{array}

Identify the correct description about the given figure:





\[
\begin{array{ll

• (1) & Compact inflorescence showing complete autogamy.
• (2) & Wind pollinated plant inflorescence showing flowers with well exposed stamens.
• (3) & Water pollinated flowers showing stamens with mucilaginous covering.
• (4) & Cleistogamous flowers showing autogamy.
  \end{array} \]

Read the following statements and choose the set of correct statements:

In the members of Phaeophyceae,

[(A)] Asexual reproduction occurs usually by biflagellate zoospores.
[(B)] Sexual reproduction is by oogamous method only.
[(C)] Stored food is in the form of carbohydrates which is either mannitol or laminarin.
[(D)] The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
[(E)] Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.



\begin{array{ll

• (1) & A, B, C and E only
• (2) & A, B, C and D only
• (3) & B, C, D and E only
• (4) & A, C, D and E only
  \end{array}

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.


\begin{array{ll

• (1) & Isocitrate \rightarrow \alpha-ketoglutaric acid
• (2) & Malic acid \rightarrow Oxaloacetic acid
• (3) & Succinic acid \rightarrow Malic acid
• (4) & Succinyl-CoA \rightarrow Succinic acid
  \end{array}

Match List I with List II
\[ \begin{array}{|c|l|c|l|} \hline \textbf{List I} & \textbf{Scientist} & \textbf{List II} & \textbf{Concept}
\hline A & Robert May & III & Global species diversity at about 7 million
B & Alexander von Humboldt & I & Species-Area relationship
C & Paul Ehrlich & IV & Rivet popper hypothesis
D & David Tilman & II & Long term ecosystem experiment using outdoor plots
\hline \end{array} \]

Match List I with List II
\[ \begin{array}{|c|l|c|l|} \hline \textbf{List I} & \textbf{Scientist} & \textbf{List II} & \textbf{Discovery/Concept}
\hline A & Frederick Griffith & III & Transformation
B & Francois Jacob \& Jacque Monod & IV & Lac operon
C & Har Gobind Khorana & I & Genetic code
D & Meselson \& Stahl & II & Semi-conservative mode of DNA replication
\hline \end{array} \]

Which of the following are fused in somatic hybridization involving two varieties of plants?

• (1) & Pollens
• (2) & Callus
• (3) & Somatic embryos
• (4) & Protoplasts

The DNA present in chloroplast is:

• (1) & Circular, single stranded
• (2) & Linear, double stranded
• (3) & Circular, double stranded
• (4) & Linear, single stranded

Match List I with List II

% Table \[ \begin{array}{|c|l|c|l|} \hline \textbf{List I (Types of Stamens)} & & \textbf{List II (Example)} &
\hline A. & Monoadelphous & I. & Citrus
B. & Diadelphous & II. & Pea
C. & Polyadelphous & III. & Lily
D. & Epiphyllous & IV. & China-rose
\hline \end{array} \]

• (1) & A-III, B-I, C-IV, D-II
• (2) & A-IV, B-II, C-I, D-III
• (3) & A-IV, B-I, C-II, D-III
• (4) & A-I, B-II, C-IV, D-III

Which of the following statement is correct regarding the process of replication in E.coli?

• (1) & The DNA dependent DNA polymerase catalyses polymerization in 5' \to 3' direction
• (2) & The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3' \to 5'
• (3) & The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' \to 3'
• (4) & The DNA dependent DNA polymerase catalyses polymerization in 5' \to 3' as well as 3' \to 5' direction

In an ecosystem, if the Net Primary Productivity (NPP) of the first trophic level is \( 100x \) (kcal m\(^{-2}\) yr\(^{-1}\)), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

• (1) & \frac{100x}{3x} (kcal m\(^{-2\) yr\(^{-1}\))}
• (2) & \frac{x}{10} (kcal m\(^{-2\) yr\(^{-1}\))}
• (3) & x (kcal m\(^{-2\) yr\(^{-1}\))}
• (4) & 10x (kcal m\(^{-2\) yr\(^{-1}\))}

Match List-I with List-II
\[ \begin{array}{|c|l|c|l|} \hline \textbf{List-I} & \textbf{Description} & \textbf{List-II} & \textbf{Description}
\hline \textbf{A} & GLUT-4 & \textbf{IV} & Enables glucose transport into cells
\textbf{B} & Insulin & \textbf{I} & Hormone
\textbf{C} & Trypsin & \textbf{II} & Enzyme
\textbf{D} & Collagen & \textbf{III} & Intercellular ground substance
\hline \end{array} \]

Match List-I with List-II
\[ \begin{array}{|c|l|c|l|} \hline \textbf{List-I} & \textbf{Description} & \textbf{List-II} & \textbf{Location}
\hline \textbf{A} & Citric acid cycle & \textbf{II} & Mitochondrial matrix
\textbf{B} & Glycolysis & \textbf{I} & Cytoplasm
\textbf{C} & Electron transport system & \textbf{IV} & Inner mitochondrial membrane
\textbf{D} & Proton gradient & \textbf{III} & Intermembrane space of mitochondria
\hline \end{array} \]

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

• (1) & Abscisic acid
• (2) & Auxin
• (3) & Gibberellin
• (4) & Cytokinin

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

• (1) & Low pCO_2 and High temperature
• (2) & High pO_2 and High pCO_2
• (3) & High pO_2 and Lesser H^+ concentration
• (4) & Low pCO_2 and High H^+ concentration

Following are the stages of cell division:


A. & \text{Gap 2 phase

B. & \text{Cytokinesis

C. & \text{Synthesis phase

D. & \text{Karyokinesis

E. & \text{Gap 1 phase



Choose the correct sequence of stages from the options given below:

• (1) & E - C - A - D - B
• (2) & C - E - D - A - B
• (3) & E - B - D - A - C
• (4) & B - D - E - A - C

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

• (1) 11^th segment
• (2) 5^th segment
• (3) 10^th segment
• (4) 8^th and 9^th segment

Match List I with List II:





Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-II, D-I
• (2) A-IV, B-III, C-III, D-I
• (3) A-II, B-I, C-IV, D-III
• (4) A-II, B-IV, C-I, D-III

Match List I with List II:

% Table




Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-III, D-I
• (2) A-I, B-III, C-II, D-IV
• (3) A-IV, B-III, C-I, D-II
• (4) A-III, B-I, C-IV, D-II

Match List I with List II:

% Table
\begin{table[h]
\centering
\renewcommand{\arraystretch{1.5
\setlength{\tabcolsep{15pt
\begin{tabular{|c|c|c|
\hline
List I & & List II

\hline
A. Cocaine & \(\rightarrow\) & III. \textit{Erythroxylum

B. Heroin & \(\rightarrow\) & IV. \textit{Papaver somniferum

C. Morphine & \(\rightarrow\) & I. Effective sedative in surgery

D. Marijuana & \(\rightarrow\) & II. \textit{Cannabis sativa

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

• (1) A-III, B-IV, C-I, D-II
• (2) A-IV, B-III, C-I, D-II
• (3) A-I, B-III, C-II, D-IV
• (4) A-II, B-I, C-III, D-IV

Three types of muscles are given as (a), (b), and (c). Identify the correct matching pair along with their location in the human body:





Name of muscle/location:

• (1)
• (a) Involuntary – Nose tip
  \hspace{7mm} (b) Skeletal – Bone
  \hspace{7mm} (c) Cardiac – Heart
• (2)
• (a) Smooth - Toes
  \hspace{7mm} (b) Skeletal – Legs
  \hspace{7mm} (c) Cardiac – Heart
• (3)
• (a) Skeletal - Triceps
  \hspace{7mm} (b) Smooth – Stomach
  \hspace{7mm} (c) Smooth – Heart
• (4)
• (a) Skeletal - Biceps
  \hspace{7mm} (b) Involuntary – Intestine
  \hspace{7mm} (c) Cardiac – Heart

Match List I with List II:

% Table




Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-II, B-III, C-I, D-IV
• (3) A-III, B-IV, C-II, D-I
• (4) A-I, B-III, C-II, D-IV

Match List I with List II:

% Table
\begin{table[h!]
\centering
\renewcommand{\arraystretch{1.2
\setlength{\tabcolsep{12pt
\begin{tabular{|c|l|c|l|
\hline
List I & & List II &

\hline
A. \( \alpha-1 \) antitrypsin & & III. Emphysema &

B. Cry IAb & & IV. Corn borer &

C. Cry IAc & & I. Cotton bollworm &

D. Enzyme replacement therapy & & II. ADA deficiency &

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-II, B-I, C-IV, D-III
• (3) A-III, B-I, C-II, D-IV
• (4) \textbf{A-III, B-IV, C-I, D-II}

Given below are some stages of human evolution.
Arrange them in correct sequence. (Past to Recent)


A. \textit{Homo habilis
B. \textit{Homo sapiens
C. \textit{Homo neanderthalensis
D. \textit{Homo erectus


Choose the correct sequence of human evolution from the options given below:

• (1) \textbf{A-D-C-B}
• (2) D-A-C-B
• (3) B-A-D-C
• (4) C-B-D-A

Which of the following is not a component of Fallopian tube?

• (A) Ampulla
• (B) \textbf{Uterine fundus}
• (C) Isthmus
• (D) Infundibulum

Match List I with List II:

% Table




% Answer choices
Choose the correct answer from the options given below:

• (A) A-III, B-I, C-IV, D-II
• (B) A-III, B-I, C-II, D-IV
• (C) A-I, B-III, C-IV, D-II
• (D) A-IV, B-I, C-II, D-III

Which of the following is not a natural/traditional contraceptive method?

% Answer choices

• (A) Vaults
• (B) Coitus interruptus
• (C) Periodic abstinence
• (D) Lactational amenorrhea

Match List I with List II:

% Creating a table for List I and List II
\begin{table[h!]
\centering
\renewcommand{\arraystretch{1.5
\begin{tabular{|c|l|c|l|
\hline
List I & & List II &

\hline
A. & \textit{Pterophyllum & I. & Hag fish

B. & \textit{Myxine & II. & Saw fish

C. & \textit{Pristis & III. & Angel fish

D. & \textit{Exocoetus & IV. & Flying fish

\hline
\end{tabular
\end{table

% Answer choices
Choose the correct answer from the options given below:

• (A) A-III, B-II, C-I, D-IV
• (B) A-II, B-I, C-III, D-IV
• (C) A-III, B-I, C-II, D-IV
• (D) A-IV, B-I, C-II, D-III

The flippers of the Penguins and Dolphins are the example of:

% Answer choices

• (A) Divergent evolution
• (B) Adaptive radiation
• (C) Natural selection
• (D) Convergent evolution

Which of the following is not a steroid hormone?

% Answer choices

• (A) Glucagon
• (B) Cortisol
• (C) Testosterone
• (D) Progesterone

Match List I with List II:

% Table structure
\begin{table[h!]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Down’s syndrome & I. & 11\(^{th}\) chromosome

B. & \(\alpha\)-Thalassemia & II. & ‘X’ chromosome

C. & \(\beta\)-Thalassemia & III. & 21\(^{st}\) chromosome

D. & Klinefelter’s syndrome & IV. & 16\(^{th}\) chromosome

\hline
\end{tabular
\end{table

% Answer choices
Choose the correct answer from the options given below:

• (A) A-IV, B-I, C-II, D-III
• (B) A-I, B-II, C-III, D-IV
• (C) A-II, B-III, C-IV, D-I
• (D) A-III, B-IV, C-I, D-II

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.

In light of the above statements, choose the most appropriate answer from the options given below:

• (A) A is not correct but R is correct.
• (B) Both A and R are correct and R is the correct explanation of A.
• (C) Both A and R are correct but R is NOT the correct explanation of A.
• (D) A is correct but R is not correct.

Match List I with List II:





Choose the correct answer from the options given below:

• (A) A-I, B-III, C-II, D-IV
• (B) A-II, B-IV, C-I, D-III
• (C) A-III, B-II, C-IV, D-I
• (D) A-II, B-I, C-IV, D-III

Match List I with List II:


\renewcommand{\arraystretch{1.5
\begin{tabular{|c|l|c|l|
\hline
List I & (Sub Phases of Prophase I) & List II & (Specific Characters)

\hline
A. & Diakinesis & I. & Synaptonemal complex formation

B. & Pachytene & II. & Completion of terminalisation of chiasmata

C. & Zygotene & III. & Chromosomes look like thin threads

D. & Leptotene & IV. & Appearance of recombination nodules

\hline
\end{tabular


Choose the correct answer from the options given below:

• (A) A-IV, B-III, C-II, D-I
• (B) A-IV, B-II, C-III, D-I
• (C) A-I, B-II, C-IV, D-III
• (D) A-II, B-IV, C-I, D-III

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

In the light of the above statements, choose the correct answer from the options given below:

• (A) A is false but R is true
• (B) Both A and R are true and R is the correct explanation of A
• (C) Both A and R are true but R is NOT the correct explanation of A
• (D) A is true but R is false

Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below:

• (A) Statement I is false but Statement II is true
• (B) Both Statement I and Statement II are true
• (C) Both Statement I and Statement II are false
• (D) Statement I is true but Statement II is false

Which of the following are Autoimmune disorders?


A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)


Choose the most appropriate answer from the options given below:

• (A) C, D \& E only
• (B) A, B \& D only
• (C) A, B \& E only
• (D) B, C \& E only

Consider the following statements:

• (A) Annelids are true coelomates
• (B) Poriferans are pseudocoelomates
• (C) Aschelminthes are acoelomates
• (D) Platyhelminthes are pseudocoelomates Choose the correct answer from the options given below:
• (A) D only
• (B) B only
• (C) A only
• (D) C only

Which one is the correct product of DNA-dependent RNA polymerase to the given template?

3' TACATGGCAAATATCCATTCA 5'


Choose the correct answer from the options given below:

• (A) 5' ATGTACCGTTTATAGGTAAGT 3'
• (B) 5' AUGUACCGUUUAAGGUAAGU 3'
• (C) 5' AUGUAAAGUUUAAGGUAAGU 3'
• (D) 5' AUGUACCGUUUAAGGGAAGU 3'

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

Choose the correct answer from the options given below:

• (A) Constant gene pool
• (B) Genetic recombination
• (C) Genetic drift
• (D) Gene migration

The “Ti plasmid” of Agrobacterium tumefaciens stands for

• (A) Temperature independent plasmid
• (B) Tumour inhibiting plasmid
• (C) Tumor independent plasmid
• (D) Tumor inducing plasmid

Given below are two statements:

Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the option given below:

• (A) Statement I is false but Statement II is true
• (B) Both Statement I and Statement II are true
• (C) Both Statement I and Statement II are false
• (D) Statement I is true but Statement II is false

Match List I with List II:


\renewcommand{\arraystretch{1.5
\begin{tabular{|c|l|c|l|
\hline
List-I & Enzyme & List-II & Bond Type

\hline
A. & Lipase & I. & Peptide bond

B. & Nuclease & II. & Ester bond

C. & Protease & III. & Glycosidic bond

D. & Amylase & IV. & Phosphodiester bond

\hline
\end{tabular


Choose the correct answer from the options given below:

• (A) A-IV, B-I, C-III, D-II
• (B) A-IV, B-II, C-III, D-I
• (C) A-III, B-II, C-I, D-IV
• (D) A-II, B-IV, C-I, D-III

Match List I with List II:


\renewcommand{\arraystretch{1.5
\begin{tabular{|c|l|c|l|
\hline
List-I & Joint Type & List-II & Function/Location

\hline
A. & Fibrous joints & I. & Adjacent vertebrae, limited movement

B. & Cartilaginous joints & II. & Humerus and Pectoral girdle, rotational movement

C. & Hinge joints & III. & Skull, don’t allow any movement

D. & Ball and socket joints & IV. & Knee, help in locomotion

\hline
\end{tabular


Choose the correct answer from the options given below:

• (A) A-III, B-I, C-IV, D-II
• (B) A-IV, B-II, C-III, D-I
• (C) A-I, B-III, C-II, D-IV
• (D) A-II, B-III, C-I, D-IV

Following are the stages of pathway for conduction of an action potential through the heart:

• (A) [A.] AV bundle
• (B) [B.] Purkinje fibres
• (C) [C.] AV node
• (D) [D.] Bundle branches
• (E) [E.] SA node Choose the correct sequence of pathway from the options given below:
• (A) E-A-D-B-C
• (B) E-C-A-D-B
• (C) A-E-C-B-D
• (D) B-D-E-C-A

Which of the following statements is incorrect?

• (A) Bio-reactors have an agitator system, an oxygen delivery system and foam control system.
• (B) A bio-reactor provides optimal growth conditions for achieving the desired product.
• (C) Most commonly used bio-reactors are of stirring type.
• (D) Bio-reactors are used to produce small scale bacterial cultures.

The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:

• (A) Gene ‘X’ is responsible for recognition sites and ‘Y’ is responsible for antibiotic resistance.
• (B) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of plasmid.
• (C) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of plasmid.
• (D) The gene ‘X’ is for protein involved in replication of plasmid and ‘Y’ for resistance to antibiotics.

Match List I with List II:


\renewcommand{\arraystretch{1.3
\begin{tabular{|c|l|c|l|
\hline
List I & & List II &

\hline
A. & Common cold & I. & \textit{Plasmodium

B. & Haemozoin & II. & Typhoid

C. & Widal test & III. & Rhinoviruses

D. & Allergy & IV. & Dust mites

\hline
\end{tabular


Choose the correct answer from the options given below:

• (A) A-IV, B-II, C-III, D-I
• (B) A-II, B-IV, C-III, D-I
• (C) A-I, B-III, C-II, D-IV
• (D) A-III, B-I, C-II, D-IV

Match List I with List II:


\renewcommand{\arraystretch{1.3
\begin{tabular{|c|l|c|l|
\hline
List I & & List II &

\hline
A. & Axoneme & I. & Centriole

B. & Cartwheel pattern & II. & Cilia and flagella

C. & Crista & III. & Chromosome

D. & Satellite & IV. & Mitochondria

\hline
\end{tabular


Choose the correct answer from the options given below:

• (A) A-II, B-I, C-IV, D-III
• (B) A-IV, B-III, C-II, D-I
• (C) A-IV, B-II, C-III, D-I
• (D) A-II, B-IV, C-I, D-III

The following are the statements about non-chordates:


[A.] Pharynx is perforated by gill slits.
[B.] Notochord is absent.
[C.] Central nervous system is dorsal.
[D.] Heart is dorsal if present.
[E.] Post anal tail is absent.


Choose the most appropriate answer from the options given below:

• (A) B, C \& D only
• (B) A \& C only
• (C) A, B \& D only
• (D) B, D \& E only

As per ABO blood grouping system, the blood group of father is B\(^+\), mother is A\(^+\) and child is O\(^+\). Their respective genotype can be


[A.] \( I^B i / I^A i i \)
[B.] \( I^B I^B / I^A i i \)
[C.] \( I^A I^B / I^A I^B \)
[D.] \( I^A i / I^B i / I^A i \)
[E.] \( i i / I^B I^A / I^A I^B \)


Choose the most appropriate answer from the options given below:

• (A) D \& E only
• (B) A only
• (C) B only
• (D) C \& B only

Match List I with List II:





Choose the correct answer from the options given below:

• (A) A-III, B-I, C-IV, D-II
• (B) A-II, B-I, C-III, D-IV
• (C) A-III, B-I, C-II, D-IV
• (D) A-I, B-II, C-IV, D-III

Match List I with List II:

\begin{table[h!]
\centering
\renewcommand{\arraystretch{1.2
\begin{tabular{|c|l|c|l|
\hline
List I & & List II &

\hline
A. & P wave & I. & Heart muscles are electrically silent.

B. & QRS complex & II. & Depolarisation of ventricles.

C. & T wave & III. & Depolarisation of atria.

D. & T-P gap & IV. & Repolarisation of ventricles.

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

• (A) A-IV, B-II, C-I, D-III
• (B) A-I, B-III, C-IV, D-II
• (C) A-III, B-II, C-IV, D-I
• (D) A-II, B-III, C-I, D-IV

Match List I with List II:

\begin{table[h!]
\centering
\renewcommand{\arraystretch{1.2
\begin{tabular{|c|l|c|l|
\hline
List I & & List II &

\hline
A. & Exophthalmic goiter & III. & Hyper secretion of thyroid hormone \& protruding eye balls.

B. & Acromegaly & IV. & Excessive secretion of growth hormone.

C. & Cushing’s syndrome & I. & Excess secretion of cortisol, moon face \& hyperglycemia.

D. & Cretinism & II. & Hypo-secretion of thyroid hormone and stunted growth.

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

• (A) A-III, B-IV, C-I, D-II
• (B) A-I, B-III, C-II, D-IV
• (C) A-IV, B-II, C-I, D-III
• (D) A-III, B-IV, C-II, D-I

Given below are two statements:

Statement I: Mitochondria and chloroplasts both are double membrane-bound organelles.

Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (A) Statement I is incorrect but Statement II is correct.
• (B) Both Statement I and Statement II are correct.
• (C) Both Statement I and Statement II are incorrect.
• (D) Statement I is correct but Statement II is incorrect.

Regarding catalytic cycle of an enzyme action, select the correct sequential steps:

• (A) Substrate enzyme complex formation.
• (B) Free enzyme ready to bind with another substrate.
• (C) Release of products.
• (D) Chemical bonds of the substrate broken.
• (E) Substrate binding to active site. Choose the correct answer from the options given below: [(1)]
• (A) E, D, C, B, A
• (B) E, A, D, C, B
• (C) A, E, B, D, C
• (D) B, A, C, D, E

Match List I with List II:


\begin{tabular{|c|l|c|l|
\hline
List I & & List II &

\hline
A. & Unicellular glandular epithelium & I. & Salivary glands

B. & Compound epithelium & II. & Pancreas

C. & Multicellular glandular epithelium & III. & Goblet cells of alimentary canal

D. & Endocrine glandular epithelium & IV. & Moist surface of buccal cavity

\hline
\end{tabular


Choose the correct answer from the options given below:

• (A) A-II, B-I, C-IV, D-III
• (B) A-II, B-I, C-III, D-IV
• (C) A-IV, B-III, C-I, D-II
• (D) A-III, B-IV, C-I, D-II

Choose the correct statement given below regarding juxta medullary nephron.

• (A) Juxta medullary nephrons outnumber the cortical nephrons.
• (B) Juxta medullary nephrons are located in the columns of Bertini.
• (C) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
• (D) Loop of Henle of juxta medullary nephron runs deep into medulla.

Given below are two statements:

Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II: Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (A) Statement I is incorrect but Statement II is correct.
• (B) Both Statement I and Statement II are correct.
• (C) Both Statement I and Statement II are incorrect.
• (D) Statement I is correct but Statement II is incorrect.

Match List I with List II related to the digestive system of cockroach:

\begin{table[h!]
\centering
\begin{tabular{|c|l|c|l|
\hline
List I & & List II &

\hline
A. & The structures used for storing of food & I. & Gizzard

B. & Ring of 6-8 blind tubules at junction of foregut and midgut. & II. & Gastric Caeca

C. & Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut. & III. & Malpighian tubules

D. & The structures used for grinding the food. & IV. & Crop

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

• (A) A-III, B-II, C-IV, D-I
• (B) A-IV, B-II, C-III, D-I
• (C) A-I, B-II, C-III, D-IV
• (D) A-IV, B-III, C-II, D-I

Given below are two statements:

Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons, and cerebrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (A) Statement I is incorrect but Statement II is correct.
• (B) Both Statement I and Statement II are correct.
• (C) Both Statement I and Statement II are incorrect.
• (D) Statement I is correct but Statement II is incorrect.

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below:

[

• (A) Statement I is false but Statement II is true.
• (B) Both Statement I and Statement II are true.
• (C) Both Statement I and Statement II are false.
• (D) Statement I is true but Statement II is false.

Match List I with List II:


\begin{tabular{|c|l|c|l|
\hline
List I & & List II &

\hline
A. & RNA polymerase III & I. & snRNPs

B. & Termination of transcription & II. & Promotor

C. & Splicing of Exons & III. & Rho factor

D. & TATA box & IV. & SnRNAs, tRNA

\hline
\end{tabular


Choose the correct answer from the options given below:

• (A) A-IV, B-III, C-I, D-II
• (B) A-II, B-IV, C-I, D-III
• (C) A-III, B-II, C-IV, D-I
• (D) A-III, B-IV, C-I, D-II

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.







Choose the correct answer from the options given below:

• (A) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
• (B) FSH, Leydig cells, Sertoli cells, spermiogenesis.
• (C) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
• (D) FSH, Sertoli cells, Leydig cells, spermatogenesis.